EMAIL THIS PAGE TO A FRIEND

ARR3

arrestin 3, retinal (X-arrestin)

56 Gene Product Result for
Synonyms: ARRX
UniProtKB ID: P36575, B5B0B9, Q5JT23, Q5JT24, Q6IBF5, Q96EN2
Gene ID:
Mouse(170735) arrestin 3, retinal
Rat(171107) arrestin 3, retinal (X-arrestin)
Zebrafish(572664) arrestin 3, retinal (X-arrestin)
domestic cat(101100789) arrestin 3, retinal (X-arrestin)
cow(281011) arrestin 3, retinal (X-arrestin)
dog(491939) arrestin 3, retinal (X-arrestin)
chicken(769109) arrestin 3, retinal
Thale Cress(842288) response regulator 3
naked mole-rat(101704707) arrestin 3, retinal (X-arrestin)
sheep(101122665) arrestin 3, retinal (X-arrestin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004312 Rosetta Predictions human pricing
XM_001053467 Rosetta Predictions rat pricing
XM_001069667 Rosetta Predictions rat pricing
NM_133205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178067 predicted 818
2 SASI_Hs01_00178068 predicted 832
3 SASI_Hs01_00178069 predicted 945
4 SASI_Hs01_00178070 predicted 521
5 SASI_Hs01_00178071 predicted 363
6 SASI_Hs01_00178072 predicted 240
7 SASI_Hs01_00178073 predicted 235
8 SASI_Hs01_00178074 predicted 1016
9 SASI_Hs02_00337339 predicted 474
10 SASI_Hs01_00178075 predicted 806
11 SASI_Hs01_00178076 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272420 predicted 272
2 SASI_Rn02_00272421 predicted 396
3 SASI_Rn02_00272422 predicted 804
4 SASI_Rn02_00272423 predicted 331
5 SASI_Rn02_00272424 predicted 373
6 SASI_Rn02_00272425 predicted 358
7 SASI_Rn02_00272426 predicted 788
8 SASI_Rn02_00272427 predicted 371
9 SASI_Rn02_00272428 predicted 362
10 SASI_Rn02_00272429 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328832 predicted 875
2 SASI_Rn02_00328833 predicted 331
3 SASI_Rn02_00328834 predicted 635
4 SASI_Rn02_00328835 predicted 216
5 SASI_Rn02_00328836 predicted 619
6 SASI_Rn02_00328837 predicted 943
7 SASI_Rn02_00328838 predicted 642
8 SASI_Rn02_00328839 predicted 702
9 SASI_Rn02_00328840 predicted 205
10 SASI_Rn02_00328841 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089981 predicted 995
2 SASI_Mm01_00089982 predicted 924
3 SASI_Mm01_00089983 predicted 378
4 SASI_Mm01_00089984 predicted 677
5 SASI_Mm01_00089985 predicted 258
6 SASI_Mm02_00338398 predicted 714
7 SASI_Mm01_00089986 predicted 681
8 SASI_Mm01_00089987 predicted 237
9 SASI_Mm01_00089988 predicted 222
10 SASI_Mm01_00089989 predicted 691
11 SASI_Mm01_00089990 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004312
ARR3 MISSION shRNA Bacterial Glycerol Stock
arrestin 3, retinal (X-arrestin)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-510s1c1
Sequence:CCGGGACAGTCTCCAAGAGAGACTACTCGAGTAGTCTCTCTTGGAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-910s1c1
Sequence:CCGGGATGGCAAACTTAAGCATGAACTCGAGTTCATGCTTAAGTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-950s1c1
Sequence:CCGGGCACAATTATTAGACCGGGAACTCGAGTTCCCGGTCTAATAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-249s1c1
Sequence:CCGGGATTGGTCTGACGTTCCGAAACTCGAGTTTCGGAACGTCAGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-1005s1c1
Sequence:CCGGCAAAGTCAGAGTCAACCTGATCTCGAGATCAGGTTGACTCTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-768s1c1
Sequence:CCGGCCTGTATTCACTAGACAAGTACTCGAGTACTTGTCTAGTGAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-1135s1c1
Sequence:CCGGGACATAGTCATCGAGGAGTTTCTCGAGAAACTCCTCGATGACTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-753s1c1
Sequence:CCGGGATCACAGATGTTGTCCTGTACTCGAGTACAGGACAACATCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-547s1c1
Sequence:CCGGCGGAAAGTACAATTTGCACCACTCGAGTGGTGCAAATTGTACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004312
ARR3 MISSION shRNA shRNA Plasmid DNA
arrestin 3, retinal (X-arrestin)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-510s1c1
Sequence:CCGGGACAGTCTCCAAGAGAGACTACTCGAGTAGTCTCTCTTGGAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-910s1c1
Sequence:CCGGGATGGCAAACTTAAGCATGAACTCGAGTTCATGCTTAAGTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-950s1c1
Sequence:CCGGGCACAATTATTAGACCGGGAACTCGAGTTCCCGGTCTAATAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-249s1c1
Sequence:CCGGGATTGGTCTGACGTTCCGAAACTCGAGTTTCGGAACGTCAGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-1005s1c1
Sequence:CCGGCAAAGTCAGAGTCAACCTGATCTCGAGATCAGGTTGACTCTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-768s1c1
Sequence:CCGGCCTGTATTCACTAGACAAGTACTCGAGTACTTGTCTAGTGAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-1135s1c1
Sequence:CCGGGACATAGTCATCGAGGAGTTTCTCGAGAAACTCCTCGATGACTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-753s1c1
Sequence:CCGGGATCACAGATGTTGTCCTGTACTCGAGTACAGGACAACATCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-547s1c1
Sequence:CCGGCGGAAAGTACAATTTGCACCACTCGAGTGGTGCAAATTGTACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004312
ARR3 MISSION shRNA Lentiviral Transduction Particles
arrestin 3, retinal (X-arrestin)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-510s1c1
Sequence:CCGGGACAGTCTCCAAGAGAGACTACTCGAGTAGTCTCTCTTGGAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-910s1c1
Sequence:CCGGGATGGCAAACTTAAGCATGAACTCGAGTTCATGCTTAAGTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-950s1c1
Sequence:CCGGGCACAATTATTAGACCGGGAACTCGAGTTCCCGGTCTAATAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-249s1c1
Sequence:CCGGGATTGGTCTGACGTTCCGAAACTCGAGTTTCGGAACGTCAGACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-1005s1c1
Sequence:CCGGCAAAGTCAGAGTCAACCTGATCTCGAGATCAGGTTGACTCTGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-768s1c1
Sequence:CCGGCCTGTATTCACTAGACAAGTACTCGAGTACTTGTCTAGTGAATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-1135s1c1
Sequence:CCGGGACATAGTCATCGAGGAGTTTCTCGAGAAACTCCTCGATGACTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004312.1-753s1c1
Sequence:CCGGGATCACAGATGTTGTCCTGTACTCGAGTACAGGACAACATCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004312.1-547s1c1
Sequence:CCGGCGGAAAGTACAATTTGCACCACTCGAGTGGTGCAAATTGTACTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133205
ARR3 MISSION shRNA Bacterial Glycerol Stock
arrestin 3, retinal (X-arrestin)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-752s1c1
Sequence:CCGGCCACAGATGTTGTCCTGTATTCTCGAGAATACAGGACAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-947s1c1
Sequence:CCGGGCACAATTCTTCGACCTGGAACTCGAGTTCCAGGTCGAAGAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-262s1c1
Sequence:CCGGCGCAAAGATCTCTATGTACAACTCGAGTTGTACATAGAGATCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-1083s1c1
Sequence:CCGGCGTGATCTTGATCCATCCAAACTCGAGTTTGGATGGATCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-645s21c1
Sequence:CCGGGATGGACAGGGAGGTTCATTACTCGAGTAATGAACCTCCCTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-402s21c1
Sequence:CCGGTAACCTGCCCTGTTCAGTAACCTCGAGGTTACTGAACAGGGCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-1146s21c1
Sequence:CCGGCATAGTCATCGAAGAGTTTATCTCGAGATAAACTCTTCGATGACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-217s21c1
Sequence:CCGGTTTCGCTATGGCCGTGATGACCTCGAGGTCATCACGGCCATAGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-172s21c1
Sequence:CCGGGAGTACTTAGAAGGTCGAAAGCTCGAGCTTTCGACCTTCTAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133205
ARR3 MISSION shRNA shRNA Plasmid DNA
arrestin 3, retinal (X-arrestin)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-752s1c1
Sequence:CCGGCCACAGATGTTGTCCTGTATTCTCGAGAATACAGGACAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-947s1c1
Sequence:CCGGGCACAATTCTTCGACCTGGAACTCGAGTTCCAGGTCGAAGAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-262s1c1
Sequence:CCGGCGCAAAGATCTCTATGTACAACTCGAGTTGTACATAGAGATCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-1083s1c1
Sequence:CCGGCGTGATCTTGATCCATCCAAACTCGAGTTTGGATGGATCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-645s21c1
Sequence:CCGGGATGGACAGGGAGGTTCATTACTCGAGTAATGAACCTCCCTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-402s21c1
Sequence:CCGGTAACCTGCCCTGTTCAGTAACCTCGAGGTTACTGAACAGGGCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-1146s21c1
Sequence:CCGGCATAGTCATCGAAGAGTTTATCTCGAGATAAACTCTTCGATGACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-217s21c1
Sequence:CCGGTTTCGCTATGGCCGTGATGACCTCGAGGTCATCACGGCCATAGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-172s21c1
Sequence:CCGGGAGTACTTAGAAGGTCGAAAGCTCGAGCTTTCGACCTTCTAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133205
ARR3 MISSION shRNA Lentiviral Transduction Particles
arrestin 3, retinal (X-arrestin)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-752s1c1
Sequence:CCGGCCACAGATGTTGTCCTGTATTCTCGAGAATACAGGACAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-947s1c1
Sequence:CCGGGCACAATTCTTCGACCTGGAACTCGAGTTCCAGGTCGAAGAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-262s1c1
Sequence:CCGGCGCAAAGATCTCTATGTACAACTCGAGTTGTACATAGAGATCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133205.1-1083s1c1
Sequence:CCGGCGTGATCTTGATCCATCCAAACTCGAGTTTGGATGGATCAAGATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-645s21c1
Sequence:CCGGGATGGACAGGGAGGTTCATTACTCGAGTAATGAACCTCCCTGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-402s21c1
Sequence:CCGGTAACCTGCCCTGTTCAGTAACCTCGAGGTTACTGAACAGGGCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-1146s21c1
Sequence:CCGGCATAGTCATCGAAGAGTTTATCTCGAGATAAACTCTTCGATGACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-217s21c1
Sequence:CCGGTTTCGCTATGGCCGTGATGACCTCGAGGTCATCACGGCCATAGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133205.2-172s21c1
Sequence:CCGGGAGTACTTAGAAGGTCGAAAGCTCGAGCTTTCGACCTTCTAAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks