EMAIL THIS PAGE TO A FRIEND

ARRB1

arrestin, beta 1

98 Gene Product Result for
Synonyms: ARB1 ARR1
UniProtKB ID: P49407, B6V9G8, O75625, O75630, Q2PP20, Q9BTK8
Gene ID:
Human(408) Summary: Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 1 is a cytosolic protein and acts as a cofactor in the beta-adrenergic receptor kinase (BARK) mediated desensitization of beta-adrenergic receptors. Besides the central nervous system, it is expressed at high levels in peripheral blood leukocytes, and thus the BARK/beta-arrestin system is believed to play a major role in regulating receptor-mediated immune functions. Alternatively spliced transcripts encoding different isoforms of arrestin beta 1 have been described. [provided by RefSeq, Jan 2011]
Mouse(109689) arrestin, beta 1
Rat(25387) arrestin, beta 1
Zebrafish(553266) arrestin, beta 1
dog(485189) arrestin, beta 1
cow(281637) arrestin, beta 1
Horse(100064657) arrestin, beta 1
domestic cat(101101078) arrestin, beta 1
sheep(101108418) arrestin, beta 1
Domestic Rabbit(100009235) arrestin, beta 1
naked mole-rat(101703451) arrestin, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004041 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004041 Rosetta Predictions human pricing
NM_020251 Rosetta Predictions human pricing
NM_012910 Rosetta Predictions rat pricing
NM_177231 Rosetta Predictions mouse pricing
NM_178220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100032 predicted 777
2 SASI_Hs02_00336791 predicted 659
3 SASI_Hs01_00100033 predicted 703
4 SASI_Hs01_00100034 predicted 686
5 SASI_Hs01_00100035 predicted 449
6 SASI_Hs01_00100036 predicted 1601
7 SASI_Hs01_00100037 predicted 548
8 SASI_Hs01_00100038 predicted 916
9 SASI_Hs01_00100039 predicted 1890
10 SASI_Hs01_00100040 predicted 575
11 SASI_Hs01_00100041 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064560 predicted 778
2 SASI_Hs02_00353204 predicted 655
3 SASI_Hs01_00064561 predicted 698
4 SASI_Hs01_00064562 predicted 682
5 SASI_Hs01_00064563 predicted 455
6 SASI_Hs01_00064564 predicted 1572
7 SASI_Hs01_00064565 predicted 549
8 SASI_Hs01_00064566 predicted 917
9 SASI_Hs01_00064567 predicted 1868
10 SASI_Hs01_00064568 predicted 579
11 SASI_Hs01_00064569 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105287 predicted 705
2 SASI_Rn01_00105288 predicted 589
3 SASI_Rn01_00105289 predicted 512
4 SASI_Rn02_00260445 predicted 625
5 SASI_Rn01_00105290 predicted 526
6 SASI_Rn01_00105291 predicted 220
7 SASI_Rn01_00105292 predicted 233
8 SASI_Rn02_00260446 predicted 237
9 SASI_Rn01_00105293 predicted 380
10 SASI_Rn01_00105294 predicted 792
11 SASI_Rn01_00105295 predicted 858
12 SASI_Rn01_00105296 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146722 predicted 638
2 SASI_Mm01_00146723 predicted 920
3 SASI_Mm01_00146724 predicted 490
4 SASI_Mm02_00347262 predicted 893
5 SASI_Mm01_00146725 predicted 769
6 SASI_Mm01_00146726 predicted 878
7 SASI_Mm01_00146727 predicted 1535
8 SASI_Mm01_00146728 predicted 1674
9 SASI_Mm01_00146729 predicted 778
10 SASI_Mm01_00146730 predicted 984
11 SASI_Mm01_00146731 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155916 predicted 635
2 SASI_Mm01_00155917 predicted 914
3 SASI_Mm01_00155918 predicted 492
4 SASI_Mm02_00348626 predicted 892
5 SASI_Mm01_00155919 predicted 765
6 SASI_Mm01_00155920 predicted 878
7 SASI_Mm01_00155921 predicted 1504
8 SASI_Mm01_00155922 predicted 1653
9 SASI_Mm01_00155923 predicted 782
10 SASI_Mm01_00155924 predicted 988
11 SASI_Mm01_00155925 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177231
VALIDATED
ARRB1 MISSION shRNA Bacterial Glycerol Stock
arrestin, beta 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-887s21c1
Sequence:CCGGCCTTGAGGCATCACTGGATAACTCGAGTTATCCAGTGATGCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-1446s21c1
Sequence:CCGGGACATTGTATTTGAGGACTTTCTCGAGAAAGTCCTCAAATACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177231.2-3400s21c1
Sequence:CCGGGCCCAGTGTTTGTTGTTATTTCTCGAGAAATAACAACAAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-1435s21c1
Sequence:CCGGCCAATGATGACGACATTGTATCTCGAGATACAATGTCGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-434s21c1
Sequence:CCGGTCTCAAAGAAAGGCGAGTCTACTCGAGTAGACTCGCCTTTCTTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-1223s1c1
Sequence:CCGGGACATTGTATTTGAGGACTTTCTCGAGAAAGTCCTCAAATACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-211s1c1
Sequence:CCGGTCTCAAAGAAAGGCGAGTCTACTCGAGTAGACTCGCCTTTCTTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-3177s1c1
Sequence:CCGGGCCCAGTGTTTGTTGTTATTTCTCGAGAAATAACAACAAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-664s1c1
Sequence:CCGGCCTTGAGGCATCACTGGATAACTCGAGTTATCCAGTGATGCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-1212s1c1
Sequence:CCGGCCAATGATGACGACATTGTATCTCGAGATACAATGTCGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177231
VALIDATED
ARRB1 MISSION shRNA shRNA Plasmid DNA
arrestin, beta 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-887s21c1
Sequence:CCGGCCTTGAGGCATCACTGGATAACTCGAGTTATCCAGTGATGCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-1446s21c1
Sequence:CCGGGACATTGTATTTGAGGACTTTCTCGAGAAAGTCCTCAAATACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177231.2-3400s21c1
Sequence:CCGGGCCCAGTGTTTGTTGTTATTTCTCGAGAAATAACAACAAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-1435s21c1
Sequence:CCGGCCAATGATGACGACATTGTATCTCGAGATACAATGTCGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-434s21c1
Sequence:CCGGTCTCAAAGAAAGGCGAGTCTACTCGAGTAGACTCGCCTTTCTTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-1223s1c1
Sequence:CCGGGACATTGTATTTGAGGACTTTCTCGAGAAAGTCCTCAAATACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-211s1c1
Sequence:CCGGTCTCAAAGAAAGGCGAGTCTACTCGAGTAGACTCGCCTTTCTTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-3177s1c1
Sequence:CCGGGCCCAGTGTTTGTTGTTATTTCTCGAGAAATAACAACAAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-664s1c1
Sequence:CCGGCCTTGAGGCATCACTGGATAACTCGAGTTATCCAGTGATGCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-1212s1c1
Sequence:CCGGCCAATGATGACGACATTGTATCTCGAGATACAATGTCGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177231
VALIDATED
ARRB1 MISSION shRNA Lentiviral Transduction Particles
arrestin, beta 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-887s21c1
Sequence:CCGGCCTTGAGGCATCACTGGATAACTCGAGTTATCCAGTGATGCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-1446s21c1
Sequence:CCGGGACATTGTATTTGAGGACTTTCTCGAGAAAGTCCTCAAATACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177231.2-3400s21c1
Sequence:CCGGGCCCAGTGTTTGTTGTTATTTCTCGAGAAATAACAACAAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-1435s21c1
Sequence:CCGGCCAATGATGACGACATTGTATCTCGAGATACAATGTCGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177231.2-434s21c1
Sequence:CCGGTCTCAAAGAAAGGCGAGTCTACTCGAGTAGACTCGCCTTTCTTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-1223s1c1
Sequence:CCGGGACATTGTATTTGAGGACTTTCTCGAGAAAGTCCTCAAATACAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-211s1c1
Sequence:CCGGTCTCAAAGAAAGGCGAGTCTACTCGAGTAGACTCGCCTTTCTTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-3177s1c1
Sequence:CCGGGCCCAGTGTTTGTTGTTATTTCTCGAGAAATAACAACAAACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-664s1c1
Sequence:CCGGCCTTGAGGCATCACTGGATAACTCGAGTTATCCAGTGATGCCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177231.1-1212s1c1
Sequence:CCGGCCAATGATGACGACATTGTATCTCGAGATACAATGTCGTCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004041
VALIDATED
ARRB1 MISSION shRNA Bacterial Glycerol Stock
arrestin, beta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-1361s21c1
Sequence:GTACCGGACACAAATGATGACGACATTGCTCGAGCAATGTCGTCATCATTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-1258s21c1
Sequence:CCGGGAACTGCCCTTCACCCTAATGCTCGAGCATTAGGGTGAAGGGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-917s21c1
Sequence:CCGGAGATCTCAGTGCGCCAGTATGCTCGAGCATACTGGCGCACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-828s21c1
Sequence:CCGGTCTGGATAAGGAGATCTATTACTCGAGTAATAGATCTCCTTATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-831s1c1
Sequence:CCGGCCTAGCCAATAACCGAGAGAACTCGAGTTCTCTCGGTTATTGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-51s1c1
Sequence:CCGGGCTCACCGTCTACCTGGGAAACTCGAGTTTCCCAGGTAGACGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-345s1c1
Sequence:CCGGCACCTTTGAGATCCCTCCAAACTCGAGTTTGGAGGGATCTCAAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-616s1c1
Sequence:CCGGGAGATCTATTACCATGGAGAACTCGAGTTCTCCATGGTAATAGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004041
VALIDATED
ARRB1 MISSION shRNA shRNA Plasmid DNA
arrestin, beta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-1361s21c1
Sequence:GTACCGGACACAAATGATGACGACATTGCTCGAGCAATGTCGTCATCATTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-1258s21c1
Sequence:CCGGGAACTGCCCTTCACCCTAATGCTCGAGCATTAGGGTGAAGGGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-917s21c1
Sequence:CCGGAGATCTCAGTGCGCCAGTATGCTCGAGCATACTGGCGCACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-828s21c1
Sequence:CCGGTCTGGATAAGGAGATCTATTACTCGAGTAATAGATCTCCTTATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-831s1c1
Sequence:CCGGCCTAGCCAATAACCGAGAGAACTCGAGTTCTCTCGGTTATTGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-51s1c1
Sequence:CCGGGCTCACCGTCTACCTGGGAAACTCGAGTTTCCCAGGTAGACGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-345s1c1
Sequence:CCGGCACCTTTGAGATCCCTCCAAACTCGAGTTTGGAGGGATCTCAAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-616s1c1
Sequence:CCGGGAGATCTATTACCATGGAGAACTCGAGTTCTCCATGGTAATAGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004041
VALIDATED
ARRB1 MISSION shRNA Lentiviral Transduction Particles
arrestin, beta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-1361s21c1
Sequence:GTACCGGACACAAATGATGACGACATTGCTCGAGCAATGTCGTCATCATTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-1258s21c1
Sequence:CCGGGAACTGCCCTTCACCCTAATGCTCGAGCATTAGGGTGAAGGGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-917s21c1
Sequence:CCGGAGATCTCAGTGCGCCAGTATGCTCGAGCATACTGGCGCACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004041.3-828s21c1
Sequence:CCGGTCTGGATAAGGAGATCTATTACTCGAGTAATAGATCTCCTTATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-831s1c1
Sequence:CCGGCCTAGCCAATAACCGAGAGAACTCGAGTTCTCTCGGTTATTGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-51s1c1
Sequence:CCGGGCTCACCGTCTACCTGGGAAACTCGAGTTTCCCAGGTAGACGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-345s1c1
Sequence:CCGGCACCTTTGAGATCCCTCCAAACTCGAGTTTGGAGGGATCTCAAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004041.2-616s1c1
Sequence:CCGGGAGATCTATTACCATGGAGAACTCGAGTTCTCCATGGTAATAGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks