EMAIL THIS PAGE TO A FRIEND

ARRB2

arrestin, beta 2

Synonyms: ARB2 ARR2 BARR2
Gene ID:
Human(409) Summary: Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
Mouse(216869) arrestin, beta 2
Rat(25388) arrestin, beta 2
naked mole-rat(101709908) arrestin, beta 2
sheep(101112493) arrestin, beta 2
Domestic Rabbit(100341204) arrestin, beta 2
Horse(100072892) arrestin, beta 2
domestic cat(101093558) arrestin, beta 2
dog(607262) arrestin, beta 2
cow(281638) arrestin, beta 2
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004313 Rosetta Predictions human pricing
NM_199004 Rosetta Predictions human pricing
NM_012911 Rosetta Predictions rat pricing
NM_145429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121428 predicted 1638
2 SASI_Hs01_00121429 predicted 1359
3 SASI_Hs01_00121430 predicted 1371
4 SASI_Hs01_00121431 predicted 974
5 SASI_Hs01_00121432 predicted 1331
6 SASI_Hs01_00121433 predicted 1612
7 SASI_Hs02_00337340 predicted 1570
8 SASI_Hs01_00121434 predicted 1335
9 SASI_Hs01_00121435 predicted 1183
10 SASI_Hs02_00337341 predicted 1301
11 SASI_Hs01_00121426 predicted 1570
12 SASI_Hs01_00121427 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129718 predicted 1596
2 SASI_Hs01_00129719 predicted 1313
3 SASI_Hs01_00129720 predicted 1318
4 SASI_Hs01_00129721 predicted 921
5 SASI_Hs01_00129722 predicted 1285
6 SASI_Hs01_00129723 predicted 1567
7 SASI_Hs02_00372520 predicted 1524
8 SASI_Hs01_00129724 predicted 1287
9 SASI_Hs01_00129725 predicted 1143
10 SASI_Hs02_00372521 predicted 1255
11 SASI_Hs01_00129716 predicted 1519
12 SASI_Hs01_00129717 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090533 predicted 1301
2 SASI_Rn01_00090534 predicted 1133
3 SASI_Rn02_00260447 predicted 862
4 SASI_Rn01_00090535 predicted 1198
5 SASI_Rn01_00090536 predicted 1396
6 SASI_Rn01_00090537 predicted 870
7 SASI_Rn01_00090538 predicted 1155
8 SASI_Rn01_00090539 predicted 932
9 SASI_Rn01_00090540 predicted 1044
10 SASI_Rn01_00090541 predicted 1325
11 SASI_Rn01_00090542 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340782 predicted 1232
2 SASI_Mm01_00076524 predicted 946
3 SASI_Mm02_00340783 predicted 1424
4 SASI_Mm02_00340784 predicted 1195
5 SASI_Mm02_00340785 predicted 1454
6 SASI_Mm01_00076525 predicted 749
7 SASI_Mm02_00340786 predicted 1211
8 SASI_Mm01_00076527 predicted 756
9 SASI_Mm02_00340787 predicted 1221
10 SASI_Mm02_00340788 predicted 1194
11 SASI_Mm01_00076521 predicted 730
12 SASI_Mm01_00076522 predicted 692
13 SASI_Mm01_00076523 predicted 597
14 SASI_Mm01_00076526 predicted 822
15 SASI_Mm01_00076528 predicted 993
16 SASI_Mm01_00076529 predicted 986
17 SASI_Mm01_00076530 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004313
VALIDATED
ARRB2 MISSION shRNA Bacterial Glycerol Stock
arrestin, beta 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-309s1c1
Sequence:CCGGCTTCGTAGATCACCTGGACAACTCGAGTTGTCCAGGTGATCTACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-682s1c1
Sequence:CCGGGCTAAATCACTAGAAGAGAAACTCGAGTTTCTCTTCTAGTGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-1702s1c1
Sequence:CCGGCAAGCTGTGTTCATACCTAAACTCGAGTTTAGGTATGAACACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-1357s1c1
Sequence:CCGGGATACCAACTATGCCACAGATCTCGAGATCTGTGGCATAGTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-453s1c1
Sequence:CCGGCTTCCGCAAAGACCTGTTCATCTCGAGATGAACAGGTCTTTGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-1370s1c1
Sequence:CCGGCCACAGATGATGACATTGTGTCTCGAGACACAATGTCATCATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-255s1c1
Sequence:CCGGCTTCAAGAAGTCGAGCCCTAACTCGAGTTAGGGCTCGACTTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-309s21c1
Sequence:CCGGCTTCGTAGATCACCTGGACAACTCGAGTTGTCCAGGTGATCTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-682s21c1
Sequence:CCGGGCTAAATCACTAGAAGAGAAACTCGAGTTTCTCTTCTAGTGATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-1702s21c1
Sequence:CCGGCAAGCTGTGTTCATACCTAAACTCGAGTTTAGGTATGAACACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-1357s21c1
Sequence:CCGGGATACCAACTATGCCACAGATCTCGAGATCTGTGGCATAGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004313
VALIDATED
ARRB2 MISSION shRNA shRNA Plasmid DNA
arrestin, beta 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-309s1c1
Sequence:CCGGCTTCGTAGATCACCTGGACAACTCGAGTTGTCCAGGTGATCTACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-682s1c1
Sequence:CCGGGCTAAATCACTAGAAGAGAAACTCGAGTTTCTCTTCTAGTGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-1702s1c1
Sequence:CCGGCAAGCTGTGTTCATACCTAAACTCGAGTTTAGGTATGAACACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-1357s1c1
Sequence:CCGGGATACCAACTATGCCACAGATCTCGAGATCTGTGGCATAGTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-453s1c1
Sequence:CCGGCTTCCGCAAAGACCTGTTCATCTCGAGATGAACAGGTCTTTGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-1370s1c1
Sequence:CCGGCCACAGATGATGACATTGTGTCTCGAGACACAATGTCATCATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-255s1c1
Sequence:CCGGCTTCAAGAAGTCGAGCCCTAACTCGAGTTAGGGCTCGACTTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-309s21c1
Sequence:CCGGCTTCGTAGATCACCTGGACAACTCGAGTTGTCCAGGTGATCTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-682s21c1
Sequence:CCGGGCTAAATCACTAGAAGAGAAACTCGAGTTTCTCTTCTAGTGATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-1702s21c1
Sequence:CCGGCAAGCTGTGTTCATACCTAAACTCGAGTTTAGGTATGAACACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-1357s21c1
Sequence:CCGGGATACCAACTATGCCACAGATCTCGAGATCTGTGGCATAGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004313
VALIDATED
ARRB2 MISSION shRNA Lentiviral Transduction Particles
arrestin, beta 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-309s1c1
Sequence:CCGGCTTCGTAGATCACCTGGACAACTCGAGTTGTCCAGGTGATCTACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-682s1c1
Sequence:CCGGGCTAAATCACTAGAAGAGAAACTCGAGTTTCTCTTCTAGTGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-1702s1c1
Sequence:CCGGCAAGCTGTGTTCATACCTAAACTCGAGTTTAGGTATGAACACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-1357s1c1
Sequence:CCGGGATACCAACTATGCCACAGATCTCGAGATCTGTGGCATAGTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-453s1c1
Sequence:CCGGCTTCCGCAAAGACCTGTTCATCTCGAGATGAACAGGTCTTTGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004313.3-1370s1c1
Sequence:CCGGCCACAGATGATGACATTGTGTCTCGAGACACAATGTCATCATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004313.3-255s1c1
Sequence:CCGGCTTCAAGAAGTCGAGCCCTAACTCGAGTTAGGGCTCGACTTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-309s21c1
Sequence:CCGGCTTCGTAGATCACCTGGACAACTCGAGTTGTCCAGGTGATCTACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-682s21c1
Sequence:CCGGGCTAAATCACTAGAAGAGAAACTCGAGTTTCTCTTCTAGTGATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-1702s21c1
Sequence:CCGGCAAGCTGTGTTCATACCTAAACTCGAGTTTAGGTATGAACACAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004313.3-1357s21c1
Sequence:CCGGGATACCAACTATGCCACAGATCTCGAGATCTGTGGCATAGTTGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145429
VALIDATED
ARRB2 MISSION shRNA Bacterial Glycerol Stock
arrestin, beta 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-529s1c1
Sequence:CCGGCGGCTTATCATCAGAAAGGTACTCGAGTACCTTTCTGATGATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145429.1-60s1c1
Sequence:CCGGCTTCAAGAAGTCCAGCCCTAACTCGAGTTAGGGCTGGACTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-172s1c1
Sequence:CCGGGACTACTTGAAGGACCGGAAACTCGAGTTTCCGGTCCTTCAAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-1152s1c1
Sequence:CCGGCCTCATCGAATTCGATACCAACTCGAGTTGGTATCGAATTCGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-485s1c1
Sequence:CCGGGTGCCAAATCAATAGAAGAAACTCGAGTTTCTTCTATTGATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-217s21c2
Sequence:CCGGGACTACTTGAAGGACCGGAAACTCGAGTTTCCGGTCCTTCAAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-530s21c1
Sequence:CCGGGTGCCAAATCAATAGAAGAAACTCGAGTTTCTTCTATTGATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145429.4-574s21c1
Sequence:CCGGCGGCTTATCATCAGAAAGGTACTCGAGTACCTTTCTGATGATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-1441s21c1
Sequence:CCGGACTTGTTGAAAGTGGGCATTACTCGAGTAATGCCCACTTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-1197s21c1
Sequence:CCGGCCTCATCGAATTCGATACCAACTCGAGTTGGTATCGAATTCGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145429
VALIDATED
ARRB2 MISSION shRNA shRNA Plasmid DNA
arrestin, beta 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-529s1c1
Sequence:CCGGCGGCTTATCATCAGAAAGGTACTCGAGTACCTTTCTGATGATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145429.1-60s1c1
Sequence:CCGGCTTCAAGAAGTCCAGCCCTAACTCGAGTTAGGGCTGGACTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-172s1c1
Sequence:CCGGGACTACTTGAAGGACCGGAAACTCGAGTTTCCGGTCCTTCAAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-1152s1c1
Sequence:CCGGCCTCATCGAATTCGATACCAACTCGAGTTGGTATCGAATTCGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-485s1c1
Sequence:CCGGGTGCCAAATCAATAGAAGAAACTCGAGTTTCTTCTATTGATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-217s21c2
Sequence:CCGGGACTACTTGAAGGACCGGAAACTCGAGTTTCCGGTCCTTCAAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-530s21c1
Sequence:CCGGGTGCCAAATCAATAGAAGAAACTCGAGTTTCTTCTATTGATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145429.4-574s21c1
Sequence:CCGGCGGCTTATCATCAGAAAGGTACTCGAGTACCTTTCTGATGATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-1441s21c1
Sequence:CCGGACTTGTTGAAAGTGGGCATTACTCGAGTAATGCCCACTTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-1197s21c1
Sequence:CCGGCCTCATCGAATTCGATACCAACTCGAGTTGGTATCGAATTCGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145429
VALIDATED
ARRB2 MISSION shRNA Lentiviral Transduction Particles
arrestin, beta 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-529s1c1
Sequence:CCGGCGGCTTATCATCAGAAAGGTACTCGAGTACCTTTCTGATGATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145429.1-60s1c1
Sequence:CCGGCTTCAAGAAGTCCAGCCCTAACTCGAGTTAGGGCTGGACTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-172s1c1
Sequence:CCGGGACTACTTGAAGGACCGGAAACTCGAGTTTCCGGTCCTTCAAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-1152s1c1
Sequence:CCGGCCTCATCGAATTCGATACCAACTCGAGTTGGTATCGAATTCGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145429.1-485s1c1
Sequence:CCGGGTGCCAAATCAATAGAAGAAACTCGAGTTTCTTCTATTGATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-217s21c2
Sequence:CCGGGACTACTTGAAGGACCGGAAACTCGAGTTTCCGGTCCTTCAAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-530s21c1
Sequence:CCGGGTGCCAAATCAATAGAAGAAACTCGAGTTTCTTCTATTGATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145429.4-574s21c1
Sequence:CCGGCGGCTTATCATCAGAAAGGTACTCGAGTACCTTTCTGATGATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295111    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-1441s21c1
Sequence:CCGGACTTGTTGAAAGTGGGCATTACTCGAGTAATGCCCACTTTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145429.4-1197s21c1
Sequence:CCGGCCTCATCGAATTCGATACCAACTCGAGTTGGTATCGAATTCGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks