EMAIL THIS PAGE TO A FRIEND

ARRDC1

arrestin domain containing 1

108 Gene Product Result for
UniProtKB ID: Q8N5I2
Gene ID:
Mouse(215705) arrestin domain containing 1
Rat(366001) arrestin domain containing 1
naked mole-rat(101702069) arrestin domain containing 1
domestic guinea pig(100735758) arrestin domain containing 1
sheep(101101973) arrestin domain containing 1
chicken(427772) arrestin domain containing 1
domestic cat(101081767) arrestin domain containing 1
cow(786098) arrestin domain containing 1
dog(100683642) arrestin domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063561 MISSION® esiRNA esiRNA human ARRDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152285 Rosetta Predictions human pricing
NM_001100770 Rosetta Predictions rat pricing
NM_178408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026901 predicted 1263
2 SASI_Hs01_00026902 predicted 577
3 SASI_Hs01_00026903 predicted 249
4 SASI_Hs01_00026904 predicted 870
5 SASI_Hs01_00026905 predicted 527
6 SASI_Hs01_00026906 predicted 1253
7 SASI_Hs01_00026907 predicted 678
8 SASI_Hs01_00026908 predicted 262
9 SASI_Hs01_00026909 predicted 610
10 SASI_Hs01_00026910 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210518 predicted 1123
2 SASI_Rn02_00210519 predicted 525
3 SASI_Rn02_00210520 predicted 1311
4 SASI_Rn02_00210521 predicted 625
5 SASI_Rn02_00210522 predicted 776
6 SASI_Rn02_00210523 predicted 435
7 SASI_Rn02_00210524 predicted 1096
8 SASI_Rn02_00210525 predicted 840
9 SASI_Rn02_00210526 predicted 351
10 SASI_Rn02_00210527 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116627 predicted 618
2 SASI_Mm01_00116628 predicted 451
3 SASI_Mm01_00116630 predicted 471
4 SASI_Mm01_00116631 predicted 1085
5 SASI_Mm01_00116633 predicted 436
6 SASI_Mm01_00116634 predicted 971
7 SASI_Mm01_00116635 predicted 323
8 SASI_Mm01_00116636 predicted 783
9 SASI_Mm02_00348849 predicted 838
10 SASI_Mm02_00348850 predicted 777
11 SASI_Mm01_00116629 predicted 1129
12 SASI_Mm01_00116632 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152285
VALIDATED
ARRDC1 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-448s21c1
Sequence:CCGGAGTGCAGCCTCGTGTTCTATACTCGAGTATAGAACACGAGGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-907s21c1
Sequence:CCGGCGGTCTTCATTGGCAATATTGCTCGAGCAATATTGCCAATGAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-486s21c1
Sequence:CCGGCTGAACAGCATCCCAGACATTCTCGAGAATGTCTGGGATGCTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-851s21c1
Sequence:CCGGCATCGACTACTACTTACAGGTCTCGAGACCTGTAAGTAGTAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-251s1c1
Sequence:CCGGGAGGAGGGTTACTTCAACAGTCTCGAGACTGTTGAAGTAACCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152285.1-845s1c1
Sequence:CCGGGACTACTACTTACAGGTCTCTCTCGAGAGAGACCTGTAAGTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-682s1c1
Sequence:CCGGGAAAGTGTCCTATAAGGCCAACTCGAGTTGGCCTTATAGGACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-476s1c1
Sequence:CCGGCTGAACAGCATCCCAGACATTCTCGAGAATGTCTGGGATGCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152285.1-841s1c1
Sequence:CCGGCATCGACTACTACTTACAGGTCTCGAGACCTGTAAGTAGTAGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152285
VALIDATED
ARRDC1 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-448s21c1
Sequence:CCGGAGTGCAGCCTCGTGTTCTATACTCGAGTATAGAACACGAGGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-907s21c1
Sequence:CCGGCGGTCTTCATTGGCAATATTGCTCGAGCAATATTGCCAATGAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-486s21c1
Sequence:CCGGCTGAACAGCATCCCAGACATTCTCGAGAATGTCTGGGATGCTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-851s21c1
Sequence:CCGGCATCGACTACTACTTACAGGTCTCGAGACCTGTAAGTAGTAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-251s1c1
Sequence:CCGGGAGGAGGGTTACTTCAACAGTCTCGAGACTGTTGAAGTAACCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152285.1-845s1c1
Sequence:CCGGGACTACTACTTACAGGTCTCTCTCGAGAGAGACCTGTAAGTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-682s1c1
Sequence:CCGGGAAAGTGTCCTATAAGGCCAACTCGAGTTGGCCTTATAGGACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-476s1c1
Sequence:CCGGCTGAACAGCATCCCAGACATTCTCGAGAATGTCTGGGATGCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152285.1-841s1c1
Sequence:CCGGCATCGACTACTACTTACAGGTCTCGAGACCTGTAAGTAGTAGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152285
VALIDATED
ARRDC1 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-448s21c1
Sequence:CCGGAGTGCAGCCTCGTGTTCTATACTCGAGTATAGAACACGAGGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-907s21c1
Sequence:CCGGCGGTCTTCATTGGCAATATTGCTCGAGCAATATTGCCAATGAAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-486s21c1
Sequence:CCGGCTGAACAGCATCCCAGACATTCTCGAGAATGTCTGGGATGCTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152285.2-851s21c1
Sequence:CCGGCATCGACTACTACTTACAGGTCTCGAGACCTGTAAGTAGTAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-251s1c1
Sequence:CCGGGAGGAGGGTTACTTCAACAGTCTCGAGACTGTTGAAGTAACCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152285.1-845s1c1
Sequence:CCGGGACTACTACTTACAGGTCTCTCTCGAGAGAGACCTGTAAGTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-682s1c1
Sequence:CCGGGAAAGTGTCCTATAAGGCCAACTCGAGTTGGCCTTATAGGACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152285.1-476s1c1
Sequence:CCGGCTGAACAGCATCCCAGACATTCTCGAGAATGTCTGGGATGCTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152285.1-841s1c1
Sequence:CCGGCATCGACTACTACTTACAGGTCTCGAGACCTGTAAGTAGTAGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178408
ARRDC1 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-835s21c1
Sequence:CCGGACCGTGACTCTCCCACTATTTCTCGAGAAATAGTGGGAGAGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178408.2-1330s21c1
Sequence:CCGGGCTAACCCATACCACCTTGTTCTCGAGAACAAGGTGGTATGGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-627s21c1
Sequence:CCGGCTTGCTACAGGTATCCTATAACTCGAGTTATAGGATACCTGTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-782s1c1
Sequence:CCGGGCCTTATCCATATCGACTATTCTCGAGAATAGTCGATATGGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-782s21c1
Sequence:CCGGGCCTTATCCATATCGACTATTCTCGAGAATAGTCGATATGGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-431s21c1
Sequence:CCGGTGAACAGCATCCCAGATATTGCTCGAGCAATATCTGGGATGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-660s1c1
Sequence:CCGGGATCTATGATGTGCGGACCATCTCGAGATGGTCCGCACATCATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-626s1c1
Sequence:CCGGGCTTGCTACAGGTATCCTATACTCGAGTATAGGATACCTGTAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178408
ARRDC1 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-835s21c1
Sequence:CCGGACCGTGACTCTCCCACTATTTCTCGAGAAATAGTGGGAGAGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178408.2-1330s21c1
Sequence:CCGGGCTAACCCATACCACCTTGTTCTCGAGAACAAGGTGGTATGGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-627s21c1
Sequence:CCGGCTTGCTACAGGTATCCTATAACTCGAGTTATAGGATACCTGTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-782s1c1
Sequence:CCGGGCCTTATCCATATCGACTATTCTCGAGAATAGTCGATATGGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-782s21c1
Sequence:CCGGGCCTTATCCATATCGACTATTCTCGAGAATAGTCGATATGGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-431s21c1
Sequence:CCGGTGAACAGCATCCCAGATATTGCTCGAGCAATATCTGGGATGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-660s1c1
Sequence:CCGGGATCTATGATGTGCGGACCATCTCGAGATGGTCCGCACATCATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-626s1c1
Sequence:CCGGGCTTGCTACAGGTATCCTATACTCGAGTATAGGATACCTGTAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178408
ARRDC1 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-835s21c1
Sequence:CCGGACCGTGACTCTCCCACTATTTCTCGAGAAATAGTGGGAGAGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178408.2-1330s21c1
Sequence:CCGGGCTAACCCATACCACCTTGTTCTCGAGAACAAGGTGGTATGGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-627s21c1
Sequence:CCGGCTTGCTACAGGTATCCTATAACTCGAGTTATAGGATACCTGTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-782s1c1
Sequence:CCGGGCCTTATCCATATCGACTATTCTCGAGAATAGTCGATATGGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-782s21c1
Sequence:CCGGGCCTTATCCATATCGACTATTCTCGAGAATAGTCGATATGGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178408.2-431s21c1
Sequence:CCGGTGAACAGCATCCCAGATATTGCTCGAGCAATATCTGGGATGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-660s1c1
Sequence:CCGGGATCTATGATGTGCGGACCATCTCGAGATGGTCCGCACATCATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178408.2-626s1c1
Sequence:CCGGGCTTGCTACAGGTATCCTATACTCGAGTATAGGATACCTGTAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks