EMAIL THIS PAGE TO A FRIEND

ARRDC2

arrestin domain containing 2

110 Gene Product Result for
Synonyms: CLONE24945
UniProtKB ID: Q8TBH0, B2RBG9, O95895, Q6ZRV9, Q8WYG6
Gene ID:
Mouse(70807) arrestin domain containing 2
Rat(306344) arrestin domain containing 2
Zebrafish(335206) arrestin domain containing 2
dog(609489) arrestin domain containing 2
cow(523285) arrestin domain containing 2
domestic cat(101092831) arrestin domain containing 2
chicken(771165) arrestin domain containing 2
sheep(101110324) arrestin domain containing 2
domestic guinea pig(100733764) arrestin domain containing 2
naked mole-rat(101718463) arrestin domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015683 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131181 MISSION® esiRNA esiRNA human ARRDC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025604 Rosetta Predictions human pricing
NM_015683 Rosetta Predictions human pricing
NM_001107303 Rosetta Predictions rat pricing
NM_027560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039371 predicted 1005
2 SASI_Hs01_00039372 predicted 1075
3 SASI_Hs01_00039373 predicted 1406
4 SASI_Hs01_00039374 predicted 702
5 SASI_Hs01_00039375 predicted 978
6 SASI_Hs01_00039376 predicted 1003
7 SASI_Hs01_00039377 predicted 715
8 SASI_Hs01_00039378 predicted 1263
9 SASI_Hs01_00039379 predicted 1015
10 SASI_Hs02_00307479 predicted 686
11 SASI_Hs01_00039380 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043610 predicted 977
2 SASI_Hs01_00043611 predicted 1048
3 SASI_Hs01_00043612 predicted 1379
4 SASI_Hs01_00043613 predicted 687
5 SASI_Hs01_00043614 predicted 962
6 SASI_Hs01_00043615 predicted 976
7 SASI_Hs01_00043616 predicted 688
8 SASI_Hs01_00043617 predicted 1242
9 SASI_Hs01_00043618 predicted 993
10 SASI_Hs02_00348333 predicted 668
11 SASI_Hs01_00043619 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227505 predicted 945
2 SASI_Rn02_00227506 predicted 858
3 SASI_Rn02_00227507 predicted 931
4 SASI_Rn02_00227508 predicted 903
5 SASI_Rn02_00227509 predicted 1185
6 SASI_Rn02_00227510 predicted 1198
7 SASI_Rn02_00227511 predicted 1186
8 SASI_Rn02_00227512 predicted 900
9 SASI_Rn02_00227513 predicted 939
10 SASI_Rn02_00227514 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092717 predicted 1963
2 SASI_Mm01_00092718 predicted 1138
3 SASI_Mm01_00092719 predicted 764
4 SASI_Mm01_00092720 predicted 1617
5 SASI_Mm01_00092721 predicted 1969
6 SASI_Mm01_00092722 predicted 1156
7 SASI_Mm01_00092723 predicted 1856
8 SASI_Mm01_00092724 predicted 1853
9 SASI_Mm01_00092725 predicted 1616
10 SASI_Mm01_00092726 predicted 1169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027560
ARRDC2 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-1156s1c1
Sequence:CCGGCTACTCACTCAAGGTCTTCGTCTCGAGACGAAGACCTTGAGTGAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-979s1c1
Sequence:CCGGCCTAGTACAGACACAGACCTTCTCGAGAAGGTCTGTGTCTGTACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-763s1c1
Sequence:CCGGGTTCACTGTCATTGAACCTGTCTCGAGACAGGTTCAATGACAGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-779s1c1
Sequence:CCGGCCTGTGGACATAAACACACCTCTCGAGAGGTGTGTTTATGTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027560.1-1969s1c1
Sequence:CCGGCCCAGGCATTAAGGTGTCTTACTCGAGTAAGACACCTTAATGCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027560.1-523s1c1
Sequence:CCGGCACTGCTTATACTCAGAGTTACTCGAGTAACTCTGAGTATAAGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027560.1-1904s1c1
Sequence:CCGGGCAGACAAGCACAGAGGAAATCTCGAGATTTCCTCTGTGCTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027560.1-701s1c1
Sequence:CCGGCGCTATTCCATCAAAGCCACTCTCGAGAGTGGCTTTGATGGAATAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-921s1c1
Sequence:CCGGTCCCTATCTTTGCGGAGATTGCTCGAGCAATCTCCGCAAAGATAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027560
ARRDC2 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-1156s1c1
Sequence:CCGGCTACTCACTCAAGGTCTTCGTCTCGAGACGAAGACCTTGAGTGAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-979s1c1
Sequence:CCGGCCTAGTACAGACACAGACCTTCTCGAGAAGGTCTGTGTCTGTACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-763s1c1
Sequence:CCGGGTTCACTGTCATTGAACCTGTCTCGAGACAGGTTCAATGACAGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-779s1c1
Sequence:CCGGCCTGTGGACATAAACACACCTCTCGAGAGGTGTGTTTATGTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027560.1-1969s1c1
Sequence:CCGGCCCAGGCATTAAGGTGTCTTACTCGAGTAAGACACCTTAATGCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027560.1-523s1c1
Sequence:CCGGCACTGCTTATACTCAGAGTTACTCGAGTAACTCTGAGTATAAGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027560.1-1904s1c1
Sequence:CCGGGCAGACAAGCACAGAGGAAATCTCGAGATTTCCTCTGTGCTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027560.1-701s1c1
Sequence:CCGGCGCTATTCCATCAAAGCCACTCTCGAGAGTGGCTTTGATGGAATAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-921s1c1
Sequence:CCGGTCCCTATCTTTGCGGAGATTGCTCGAGCAATCTCCGCAAAGATAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027560
ARRDC2 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-1156s1c1
Sequence:CCGGCTACTCACTCAAGGTCTTCGTCTCGAGACGAAGACCTTGAGTGAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-979s1c1
Sequence:CCGGCCTAGTACAGACACAGACCTTCTCGAGAAGGTCTGTGTCTGTACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-763s1c1
Sequence:CCGGGTTCACTGTCATTGAACCTGTCTCGAGACAGGTTCAATGACAGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-779s1c1
Sequence:CCGGCCTGTGGACATAAACACACCTCTCGAGAGGTGTGTTTATGTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027560.1-1969s1c1
Sequence:CCGGCCCAGGCATTAAGGTGTCTTACTCGAGTAAGACACCTTAATGCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027560.1-523s1c1
Sequence:CCGGCACTGCTTATACTCAGAGTTACTCGAGTAACTCTGAGTATAAGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027560.1-1904s1c1
Sequence:CCGGGCAGACAAGCACAGAGGAAATCTCGAGATTTCCTCTGTGCTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027560.1-701s1c1
Sequence:CCGGCGCTATTCCATCAAAGCCACTCTCGAGAGTGGCTTTGATGGAATAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027560.1-921s1c1
Sequence:CCGGTCCCTATCTTTGCGGAGATTGCTCGAGCAATCTCCGCAAAGATAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015683
ARRDC2 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-452s1c1
Sequence:CCGGCCATGAGTTCCTGTTCAGCTTCTCGAGAAGCTGAACAGGAACTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-1268s1c1
Sequence:CCGGCTACATCCAAGAGTTCCGCTACTCGAGTAGCGGAACTCTTGGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1989s1c1
Sequence:CCGGGAAAGCAGGTTGTCAGAGCTACTCGAGTAGCTCTGACAACCTGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1595s1c1
Sequence:CCGGGCAGTATCCGAGAGACTGTTTCTCGAGAAACAGTCTCTCGGATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1862s1c1
Sequence:CCGGGAGCTGAGTGACGTTTGGAATCTCGAGATTCCAAACGTCACTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165724    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1824s1c1
Sequence:CCGGCAGGCAGACGAATGAGGAATACTCGAGTATTCCTCATTCGTCTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-581s1c1
Sequence:CCGGGAAGGTGTTCACTGTCATCGACTCGAGTCGATGACAGTGAACACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-2039s1c1
Sequence:CCGGGCTCCAGCCTTTGAAGACTTTCTCGAGAAAGTCTTCAAAGGCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015683.1-986s21c1
Sequence:CCGGACTCAAGGTCTGTGTGGATATCTCGAGATATCCACACAGACCTTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015683.1-514s21c1
Sequence:CCGGACGGTAGTGTCCGCTACTGTACTCGAGTACAGTAGCGGACACTACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015683.1-1568s21c1
Sequence:CCGGGTCCTTGTGAGGCATTGAATGCTCGAGCATTCAATGCCTCACAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015683
ARRDC2 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-452s1c1
Sequence:CCGGCCATGAGTTCCTGTTCAGCTTCTCGAGAAGCTGAACAGGAACTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-1268s1c1
Sequence:CCGGCTACATCCAAGAGTTCCGCTACTCGAGTAGCGGAACTCTTGGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1989s1c1
Sequence:CCGGGAAAGCAGGTTGTCAGAGCTACTCGAGTAGCTCTGACAACCTGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1595s1c1
Sequence:CCGGGCAGTATCCGAGAGACTGTTTCTCGAGAAACAGTCTCTCGGATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1862s1c1
Sequence:CCGGGAGCTGAGTGACGTTTGGAATCTCGAGATTCCAAACGTCACTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165724    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1824s1c1
Sequence:CCGGCAGGCAGACGAATGAGGAATACTCGAGTATTCCTCATTCGTCTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-581s1c1
Sequence:CCGGGAAGGTGTTCACTGTCATCGACTCGAGTCGATGACAGTGAACACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-2039s1c1
Sequence:CCGGGCTCCAGCCTTTGAAGACTTTCTCGAGAAAGTCTTCAAAGGCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015683.1-986s21c1
Sequence:CCGGACTCAAGGTCTGTGTGGATATCTCGAGATATCCACACAGACCTTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015683.1-514s21c1
Sequence:CCGGACGGTAGTGTCCGCTACTGTACTCGAGTACAGTAGCGGACACTACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015683.1-1568s21c1
Sequence:CCGGGTCCTTGTGAGGCATTGAATGCTCGAGCATTCAATGCCTCACAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015683
ARRDC2 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-452s1c1
Sequence:CCGGCCATGAGTTCCTGTTCAGCTTCTCGAGAAGCTGAACAGGAACTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-1268s1c1
Sequence:CCGGCTACATCCAAGAGTTCCGCTACTCGAGTAGCGGAACTCTTGGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165292    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1989s1c1
Sequence:CCGGGAAAGCAGGTTGTCAGAGCTACTCGAGTAGCTCTGACAACCTGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164960    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1595s1c1
Sequence:CCGGGCAGTATCCGAGAGACTGTTTCTCGAGAAACAGTCTCTCGGATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1862s1c1
Sequence:CCGGGAGCTGAGTGACGTTTGGAATCTCGAGATTCCAAACGTCACTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165724    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-1824s1c1
Sequence:CCGGCAGGCAGACGAATGAGGAATACTCGAGTATTCCTCATTCGTCTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015683.1-581s1c1
Sequence:CCGGGAAGGTGTTCACTGTCATCGACTCGAGTCGATGACAGTGAACACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015683.1-2039s1c1
Sequence:CCGGGCTCCAGCCTTTGAAGACTTTCTCGAGAAAGTCTTCAAAGGCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015683.1-986s21c1
Sequence:CCGGACTCAAGGTCTGTGTGGATATCTCGAGATATCCACACAGACCTTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015683.1-514s21c1
Sequence:CCGGACGGTAGTGTCCGCTACTGTACTCGAGTACAGTAGCGGACACTACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015683.1-1568s21c1
Sequence:CCGGGTCCTTGTGAGGCATTGAATGCTCGAGCATTCAATGCCTCACAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)