EMAIL THIS PAGE TO A FRIEND

ARRDC3

arrestin domain containing 3

227 Gene Product Result for
Synonyms: TLIMP
UniProtKB ID: Q96B67, A8K6T8, Q9P2H1
Gene ID:
Mouse(105171) arrestin domain containing 3
Rat(309945) arrestin domain containing 3
naked mole-rat(101722384) arrestin domain containing 3
domestic guinea pig(100722864) arrestin domain containing 3
sheep(101107094) arrestin domain containing 3
Domestic Rabbit(100340323) arrestin domain containing 3
chicken(427107) arrestin domain containing 3
dog(488912) arrestin domain containing 3
cow(541123) arrestin domain containing 3
Horse(100065030) arrestin domain containing 3
domestic cat(101100696) arrestin domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020801 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020801 Rosetta Predictions human pricing
NM_001007797 Rosetta Predictions rat pricing
XM_579182 Rosetta Predictions rat pricing
NM_001042591 Rosetta Predictions mouse pricing
NM_178917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057543 predicted 1331
2 SASI_Hs01_00057544 predicted 413
3 SASI_Hs01_00057545 predicted 407
4 SASI_Hs01_00057546 predicted 1244
5 SASI_Hs01_00057547 predicted 607
6 SASI_Hs01_00057548 predicted 468
7 SASI_Hs01_00057549 predicted 697
8 SASI_Hs01_00057551 predicted 1126
9 SASI_Hs02_00353975 predicted 521
10 SASI_Hs01_00057552 predicted 437
11 SASI_Hs01_00057550 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084413 predicted 266
2 SASI_Rn01_00084414 predicted 200
3 SASI_Rn01_00084415 predicted 902
4 SASI_Rn01_00084416 predicted 289
5 SASI_Rn01_00084417 predicted 755
6 SASI_Rn01_00084418 predicted 251
7 SASI_Rn01_00084419 predicted 229
8 SASI_Rn01_00084420 predicted 799
9 SASI_Rn01_00084421 predicted 607
10 SASI_Rn01_00084422 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168225 predicted 276
2 SASI_Rn01_00168226 predicted 207
3 SASI_Rn01_00168227 predicted 385
4 SASI_Rn01_00168228 predicted 294
5 SASI_Rn01_00168229 predicted 670
6 SASI_Rn01_00168230 predicted 262
7 SASI_Rn01_00168231 predicted 234
8 SASI_Rn01_00168232 predicted 224
9 SASI_Rn01_00168233 predicted 483
10 SASI_Rn01_00168234 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290655 predicted 844
2 SASI_Mm02_00290656 predicted 492
3 SASI_Mm02_00290657 predicted 434
4 SASI_Mm02_00290658 predicted 1090
5 SASI_Mm02_00290659 predicted 421
6 SASI_Mm02_00290660 predicted 624
7 SASI_Mm02_00290661 predicted 834
8 SASI_Mm02_00290662 predicted 479
9 SASI_Mm02_00290663 predicted 802
10 SASI_Mm02_00290664 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026465 predicted 866
2 SASI_Mm01_00026466 predicted 506
3 SASI_Mm01_00026467 predicted 446
4 SASI_Mm01_00026468 predicted 1106
5 SASI_Mm01_00026469 predicted 432
6 SASI_Mm01_00026470 predicted 645
7 SASI_Mm01_00026471 predicted 852
8 SASI_Mm01_00026472 predicted 494
9 SASI_Mm01_00026473 predicted 812
10 SASI_Mm01_00026474 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020801
VALIDATED
ARRDC3 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_020801.2-512s21c1
Sequence:CCGGACGAAAGAGATGATGATAATTCTCGAGAATTATCATCATCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-1068s21c1
Sequence:CCGGTATCCTCGACTGTAGTATAATCTCGAGATTATACTACAGTCGAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-476s21c1
Sequence:CCGGTAGAGTATTTCAACCATAAAGCTCGAGCTTTATGGTTGAAATACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-795s21c1
Sequence:CCGGCTGTACCTCAGGCCCAATATCCTCGAGGATATTGGGCCTGAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020801.2-2855s21c1
Sequence:CCGGAGAACGTTTGCTGCGATAAATCTCGAGATTTATCGCAGCAAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020801
VALIDATED
ARRDC3 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_020801.2-512s21c1
Sequence:CCGGACGAAAGAGATGATGATAATTCTCGAGAATTATCATCATCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-1068s21c1
Sequence:CCGGTATCCTCGACTGTAGTATAATCTCGAGATTATACTACAGTCGAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-476s21c1
Sequence:CCGGTAGAGTATTTCAACCATAAAGCTCGAGCTTTATGGTTGAAATACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-795s21c1
Sequence:CCGGCTGTACCTCAGGCCCAATATCCTCGAGGATATTGGGCCTGAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020801.2-2855s21c1
Sequence:CCGGAGAACGTTTGCTGCGATAAATCTCGAGATTTATCGCAGCAAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020801
VALIDATED
ARRDC3 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_020801.2-512s21c1
Sequence:CCGGACGAAAGAGATGATGATAATTCTCGAGAATTATCATCATCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-1068s21c1
Sequence:CCGGTATCCTCGACTGTAGTATAATCTCGAGATTATACTACAGTCGAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-476s21c1
Sequence:CCGGTAGAGTATTTCAACCATAAAGCTCGAGCTTTATGGTTGAAATACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020801.2-795s21c1
Sequence:CCGGCTGTACCTCAGGCCCAATATCCTCGAGGATATTGGGCCTGAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020801.2-2855s21c1
Sequence:CCGGAGAACGTTTGCTGCGATAAATCTCGAGATTTATCGCAGCAAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042591
ARRDC3 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000215739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001042591.1-3649s1c1
Sequence:CCGGGTTCGACAAAGTACTCTATTACTCGAGTAATAGAGTACTTTGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042591.1-474s1c1
Sequence:CCGGCAACCATAAAGACATCTTAATCTCGAGATTAAGATGTCTTTATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042591.1-314s1c1
Sequence:CCGGCTGTCTCAGGAAGGGTAAATTCTCGAGAATTTACCCTTCCTGAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042591
ARRDC3 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000215739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001042591.1-3649s1c1
Sequence:CCGGGTTCGACAAAGTACTCTATTACTCGAGTAATAGAGTACTTTGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042591.1-474s1c1
Sequence:CCGGCAACCATAAAGACATCTTAATCTCGAGATTAAGATGTCTTTATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042591.1-314s1c1
Sequence:CCGGCTGTCTCAGGAAGGGTAAATTCTCGAGAATTTACCCTTCCTGAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042591
ARRDC3 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000215739    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001042591.1-3649s1c1
Sequence:CCGGGTTCGACAAAGTACTCTATTACTCGAGTAATAGAGTACTTTGTCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042591.1-474s1c1
Sequence:CCGGCAACCATAAAGACATCTTAATCTCGAGATTAAGATGTCTTTATGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001042591.1-314s1c1
Sequence:CCGGCTGTCTCAGGAAGGGTAAATTCTCGAGAATTTACCCTTCCTGAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178917
ARRDC3 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178917.2-1448s1c1
Sequence:CCGGCCACCTCTCTATTCAGAGATTCTCGAGAATCTCTGAATAGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178917.2-279s1c1
Sequence:CCGGGACTGTCTTAATGACAGTAATCTCGAGATTACTGTCATTAAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178917.2-1102s1c1
Sequence:CCGGCGCTAATGGTGTACGTGGATACTCGAGTATCCACGTACACCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178917.2-1902s1c1
Sequence:CCGGGCCAGACTCTTGATACTCTTACTCGAGTAAGAGTATCAAGAGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178917.2-850s1c1
Sequence:CCGGCAGGTGAATCAATCCAGATATCTCGAGATATCTGGATTGATTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178917
ARRDC3 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178917.2-1448s1c1
Sequence:CCGGCCACCTCTCTATTCAGAGATTCTCGAGAATCTCTGAATAGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178917.2-279s1c1
Sequence:CCGGGACTGTCTTAATGACAGTAATCTCGAGATTACTGTCATTAAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178917.2-1102s1c1
Sequence:CCGGCGCTAATGGTGTACGTGGATACTCGAGTATCCACGTACACCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178917.2-1902s1c1
Sequence:CCGGGCCAGACTCTTGATACTCTTACTCGAGTAAGAGTATCAAGAGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178917.2-850s1c1
Sequence:CCGGCAGGTGAATCAATCCAGATATCTCGAGATATCTGGATTGATTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178917
ARRDC3 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178917.2-1448s1c1
Sequence:CCGGCCACCTCTCTATTCAGAGATTCTCGAGAATCTCTGAATAGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178917.2-279s1c1
Sequence:CCGGGACTGTCTTAATGACAGTAATCTCGAGATTACTGTCATTAAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178917.2-1102s1c1
Sequence:CCGGCGCTAATGGTGTACGTGGATACTCGAGTATCCACGTACACCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178917.2-1902s1c1
Sequence:CCGGGCCAGACTCTTGATACTCTTACTCGAGTAAGAGTATCAAGAGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178917.2-850s1c1
Sequence:CCGGCAGGTGAATCAATCCAGATATCTCGAGATATCTGGATTGATTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks