EMAIL THIS PAGE TO A FRIEND

ARRDC4

arrestin domain containing 4

181 Gene Product Result for
UniProtKB ID: Q8NCT1, Q6NSI9
Gene ID:
Mouse(66412) arrestin domain containing 4
Rat(293019) arrestin domain containing 4
chicken(415509) arrestin domain containing 4
Horse(100055139) arrestin domain containing 4
cow(538517) arrestin domain containing 4
domestic cat(101097978) arrestin domain containing 4
dog(488713) arrestin domain containing 4
domestic guinea pig(100734559) arrestin domain containing 4
naked mole-rat(101710828) arrestin domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_041721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_041721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_041721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183376 Rosetta Predictions human pricing
NM_001047853 Rosetta Predictions rat pricing
NM_001042592 Rosetta Predictions mouse pricing
NM_025549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371281 predicted 1396
2 SASI_Hs01_00247271 predicted 994
3 SASI_Hs01_00247273 predicted 779
4 SASI_Hs02_00371282 predicted 1143
5 SASI_Hs01_00247275 predicted 645
6 SASI_Hs01_00247276 predicted 630
7 SASI_Hs01_00247278 predicted 609
8 SASI_Hs02_00371283 predicted 1391
9 SASI_Hs02_00371284 predicted 1229
10 SASI_Hs01_00247279 predicted 849
11 SASI_Hs01_00247272 predicted 1011
12 SASI_Hs01_00247274 predicted 532
13 SASI_Hs01_00247277 predicted 597
14 SASI_Hs01_00247280 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206205 predicted 223
2 SASI_Rn02_00206206 predicted 437
3 SASI_Rn02_00206207 predicted 611
4 SASI_Rn02_00206208 predicted 539
5 SASI_Rn02_00206209 predicted 540
6 SASI_Rn02_00206210 predicted 483
7 SASI_Rn02_00206211 predicted 508
8 SASI_Rn02_00206212 predicted 548
9 SASI_Rn02_00206213 predicted 435
10 SASI_Rn02_00206214 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290665 predicted 545
2 SASI_Mm02_00290666 predicted 503
3 SASI_Mm02_00290667 predicted 413
4 SASI_Mm02_00290668 predicted 555
5 SASI_Mm02_00290669 predicted 462
6 SASI_Mm02_00290670 predicted 534
7 SASI_Mm02_00290671 predicted 530
8 SASI_Mm02_00290672 predicted 678
9 SASI_Mm02_00290673 predicted 736
10 SASI_Mm02_00290674 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034795 predicted 536
2 SASI_Mm01_00034796 predicted 504
3 SASI_Mm01_00034797 predicted 414
4 SASI_Mm01_00034798 predicted 553
5 SASI_Mm01_00034800 predicted 529
6 SASI_Mm01_00034801 predicted 527
7 SASI_Mm01_00034802 predicted 678
8 SASI_Mm01_00034803 predicted 741
9 SASI_Mm02_00328494 predicted 789
10 SASI_Mm01_00034804 predicted 250
11 SASI_Mm01_00034799 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_041721
VALIDATED
ARRDC4 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_041721.4-2101s1c1
Sequence:CCGGCGGTATTATGAAACCAAGAAACTCGAGTTTCTTGGTTTCATAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_041721.4-1140s1c1
Sequence:CCGGGCCATTAGTGATCGGTACAATCTCGAGATTGTACCGATCACTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_041721.4-568s1c1
Sequence:CCGGCGCTTTCAACTTCCATCTGAACTCGAGTTCAGATGGAAGTTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_041721.4-1067s1c1
Sequence:CCGGGCATTATCAGAGTGGACTATTCTCGAGAATAGTCCACTCTGATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_041721.4-1258s1c1
Sequence:CCGGGCACCACCAAATTATGCAGATCTCGAGATCTGCATAATTTGGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_041721
VALIDATED
ARRDC4 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_041721.4-2101s1c1
Sequence:CCGGCGGTATTATGAAACCAAGAAACTCGAGTTTCTTGGTTTCATAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_041721.4-1140s1c1
Sequence:CCGGGCCATTAGTGATCGGTACAATCTCGAGATTGTACCGATCACTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_041721.4-568s1c1
Sequence:CCGGCGCTTTCAACTTCCATCTGAACTCGAGTTCAGATGGAAGTTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_041721.4-1067s1c1
Sequence:CCGGGCATTATCAGAGTGGACTATTCTCGAGAATAGTCCACTCTGATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_041721.4-1258s1c1
Sequence:CCGGGCACCACCAAATTATGCAGATCTCGAGATCTGCATAATTTGGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_041721
VALIDATED
ARRDC4 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_041721.4-2101s1c1
Sequence:CCGGCGGTATTATGAAACCAAGAAACTCGAGTTTCTTGGTTTCATAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_041721.4-1140s1c1
Sequence:CCGGGCCATTAGTGATCGGTACAATCTCGAGATTGTACCGATCACTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_041721.4-568s1c1
Sequence:CCGGCGCTTTCAACTTCCATCTGAACTCGAGTTCAGATGGAAGTTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_041721.4-1067s1c1
Sequence:CCGGGCATTATCAGAGTGGACTATTCTCGAGAATAGTCCACTCTGATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_041721.4-1258s1c1
Sequence:CCGGGCACCACCAAATTATGCAGATCTCGAGATCTGCATAATTTGGTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183376
ARRDC4 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 4
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000432263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183376.2-818s21c1
Sequence:CCGGATTGTTCCTCTCGTCTGATTGCTCGAGCAATCAGACGAGAGGAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183376.2-1771s21c1
Sequence:CCGGAGAGTGGAACGAAGGCGATATCTCGAGATATCGCCTTCGTTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183376
ARRDC4 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 4
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000432263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183376.2-818s21c1
Sequence:CCGGATTGTTCCTCTCGTCTGATTGCTCGAGCAATCAGACGAGAGGAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183376.2-1771s21c1
Sequence:CCGGAGAGTGGAACGAAGGCGATATCTCGAGATATCGCCTTCGTTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183376
ARRDC4 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 4
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000432263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183376.2-818s21c1
Sequence:CCGGATTGTTCCTCTCGTCTGATTGCTCGAGCAATCAGACGAGAGGAACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183376.2-1771s21c1
Sequence:CCGGAGAGTGGAACGAAGGCGATATCTCGAGATATCGCCTTCGTTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042592
VALIDATED
ARRDC4 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-538s21c1
Sequence:CCGGACCTTTGGCAACATCGTTTACCTCGAGGTAAACGATGTTGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042592.2-1091s21c1
Sequence:CCGGCCTTTGGTTATTGGTACAATTCTCGAGAATTGTACCAATAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-663s21c1
Sequence:CCGGATGTCAACACACCGCCCTTATCTCGAGATAAGGGCGGTGTGTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042592.2-1030s21c1
Sequence:CCGGGGACTACTCCTTAGCTGTATACTCGAGTATACAGCTAAGGAGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-1604s21c1
Sequence:CCGGGGCTCCCTTGCACGCTTTAAACTCGAGTTTAAAGCGTGCAAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042592
VALIDATED
ARRDC4 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-538s21c1
Sequence:CCGGACCTTTGGCAACATCGTTTACCTCGAGGTAAACGATGTTGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042592.2-1091s21c1
Sequence:CCGGCCTTTGGTTATTGGTACAATTCTCGAGAATTGTACCAATAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-663s21c1
Sequence:CCGGATGTCAACACACCGCCCTTATCTCGAGATAAGGGCGGTGTGTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042592.2-1030s21c1
Sequence:CCGGGGACTACTCCTTAGCTGTATACTCGAGTATACAGCTAAGGAGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-1604s21c1
Sequence:CCGGGGCTCCCTTGCACGCTTTAAACTCGAGTTTAAAGCGTGCAAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042592
VALIDATED
ARRDC4 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-538s21c1
Sequence:CCGGACCTTTGGCAACATCGTTTACCTCGAGGTAAACGATGTTGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042592.2-1091s21c1
Sequence:CCGGCCTTTGGTTATTGGTACAATTCTCGAGAATTGTACCAATAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-663s21c1
Sequence:CCGGATGTCAACACACCGCCCTTATCTCGAGATAAGGGCGGTGTGTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042592.2-1030s21c1
Sequence:CCGGGGACTACTCCTTAGCTGTATACTCGAGTATACAGCTAAGGAGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001042592.2-1604s21c1
Sequence:CCGGGGCTCCCTTGCACGCTTTAAACTCGAGTTTAAAGCGTGCAAGGGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks