EMAIL THIS PAGE TO A FRIEND

ARRDC5

arrestin domain containing 5

64 Gene Product Result for
UniProtKB ID: A6NEK1
Gene ID:
Mouse(76920) arrestin domain containing 5
Rat(680452) arrestin domain containing 5
naked mole-rat(101720533) arrestin domain containing 5
domestic guinea pig(100717034) arrestin domain containing 5
sheep(101110504) arrestin domain containing 5
Horse(100062384) arrestin domain containing 5
dog(476742) arrestin domain containing 5
cow(617727) arrestin domain containing 5
domestic cat(101083403) arrestin domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102541 MISSION® esiRNA esiRNA human ARRDC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080523 Rosetta Predictions human pricing
XM_928471 Rosetta Predictions human pricing
NM_001109408 Rosetta Predictions rat pricing
NM_029799 Rosetta Predictions mouse pricing
XM_128722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315667 predicted 355
2 SASI_Hs02_00315668 predicted 462
3 SASI_Hs02_00315669 predicted 278
4 SASI_Hs02_00315670 predicted 560
5 SASI_Hs02_00315671 predicted 922
6 SASI_Hs02_00315672 predicted 434
7 SASI_Hs02_00315673 predicted 354
8 SASI_Hs02_00315674 predicted 460
9 SASI_Hs02_00315675 predicted 437
10 SASI_Hs02_00315676 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255462 predicted 232
2 SASI_Hs01_00255463 predicted 256
3 SASI_Hs01_00255464 predicted 237
4 SASI_Hs01_00255465 predicted 272
5 SASI_Hs01_00255466 predicted 240
6 SASI_Hs01_00255467 predicted 262
7 SASI_Hs01_00255468 predicted 233
8 SASI_Hs01_00255469 predicted 259
9 SASI_Hs01_00255470 predicted 233
10 SASI_Hs01_00255471 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248117 predicted 307
2 SASI_Rn02_00248118 predicted 694
3 SASI_Rn02_00248119 predicted 409
4 SASI_Rn02_00248120 predicted 587
5 SASI_Rn02_00248121 predicted 272
6 SASI_Rn02_00248122 predicted 442
7 SASI_Rn02_00248123 predicted 470
8 SASI_Rn02_00248124 predicted 729
9 SASI_Rn02_00248125 predicted 697
10 SASI_Rn02_00248126 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335943 predicted 204
2 SASI_Mm02_00335944 predicted 223
3 SASI_Mm02_00335945 predicted 214
4 SASI_Mm02_00335946 predicted 633
5 SASI_Mm02_00335947 predicted 608
6 SASI_Mm02_00335948 predicted 314
7 SASI_Mm02_00335949 predicted 520
8 SASI_Mm02_00335950 predicted 475
9 SASI_Mm02_00335951 predicted 493
10 SASI_Mm02_00335952 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254544 predicted 213
2 SASI_Mm01_00254545 predicted 234
3 SASI_Mm01_00254546 predicted 215
4 SASI_Mm01_00254547 predicted 633
5 SASI_Mm01_00254548 predicted 616
6 SASI_Mm01_00254549 predicted 316
7 SASI_Mm01_00254550 predicted 519
8 SASI_Mm01_00254551 predicted 490
9 SASI_Mm01_00254552 predicted 495
10 SASI_Mm01_00254553 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080523
ARRDC5 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-983s21c1
Sequence:CCGGTGTCAGAGGACGGAGTGTTACCTCGAGGTAACACTCCGTCCTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080523.1-1349s21c1
Sequence:CCGGCTGCTAATGTCTGGTTGTATTCTCGAGAATACAACCAGACATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-50s21c1
Sequence:CCGGTGGTGAAGTCGATCGAATTAGCTCGAGCTAATTCGATCGACTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-651s21c1
Sequence:CCGGATGCATCAAGACGGTCGTATTCTCGAGAATACGACCGTCTTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-287s21c1
Sequence:CCGGCAGTGGAGGATAATTGGTTAACTCGAGTTAACCAATTATCCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080523
ARRDC5 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-983s21c1
Sequence:CCGGTGTCAGAGGACGGAGTGTTACCTCGAGGTAACACTCCGTCCTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080523.1-1349s21c1
Sequence:CCGGCTGCTAATGTCTGGTTGTATTCTCGAGAATACAACCAGACATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-50s21c1
Sequence:CCGGTGGTGAAGTCGATCGAATTAGCTCGAGCTAATTCGATCGACTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-651s21c1
Sequence:CCGGATGCATCAAGACGGTCGTATTCTCGAGAATACGACCGTCTTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-287s21c1
Sequence:CCGGCAGTGGAGGATAATTGGTTAACTCGAGTTAACCAATTATCCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080523
ARRDC5 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-983s21c1
Sequence:CCGGTGTCAGAGGACGGAGTGTTACCTCGAGGTAACACTCCGTCCTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080523.1-1349s21c1
Sequence:CCGGCTGCTAATGTCTGGTTGTATTCTCGAGAATACAACCAGACATTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-50s21c1
Sequence:CCGGTGGTGAAGTCGATCGAATTAGCTCGAGCTAATTCGATCGACTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-651s21c1
Sequence:CCGGATGCATCAAGACGGTCGTATTCTCGAGAATACGACCGTCTTGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080523.1-287s21c1
Sequence:CCGGCAGTGGAGGATAATTGGTTAACTCGAGTTAACCAATTATCCTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029799
ARRDC5 MISSION shRNA Bacterial Glycerol Stock
arrestin domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-319s21c1
Sequence:CCGGCCACACCTTTGACTTCCATTTCTCGAGAAATGGAAGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-190s21c1
Sequence:CCGGCGTTGAGTGGAACGAAGAAATCTCGAGATTTCTTCGTTCCACTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-253s21c1
Sequence:CCGGTAAGGCAGATTACGTACATAACTCGAGTTATGTACGTAATCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-381s21c1
Sequence:CCGGTCGGCCACATCTCCTACTTTGCTCGAGCAAAGTAGGAGATGTGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-478s21c1
Sequence:CCGGGTTCCGCCAGAGGAATCTAAGCTCGAGCTTAGATTCCTCTGGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029799
ARRDC5 MISSION shRNA shRNA Plasmid DNA
arrestin domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-319s21c1
Sequence:CCGGCCACACCTTTGACTTCCATTTCTCGAGAAATGGAAGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-190s21c1
Sequence:CCGGCGTTGAGTGGAACGAAGAAATCTCGAGATTTCTTCGTTCCACTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-253s21c1
Sequence:CCGGTAAGGCAGATTACGTACATAACTCGAGTTATGTACGTAATCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-381s21c1
Sequence:CCGGTCGGCCACATCTCCTACTTTGCTCGAGCAAAGTAGGAGATGTGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-478s21c1
Sequence:CCGGGTTCCGCCAGAGGAATCTAAGCTCGAGCTTAGATTCCTCTGGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029799
ARRDC5 MISSION shRNA Lentiviral Transduction Particles
arrestin domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-319s21c1
Sequence:CCGGCCACACCTTTGACTTCCATTTCTCGAGAAATGGAAGTCAAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-190s21c1
Sequence:CCGGCGTTGAGTGGAACGAAGAAATCTCGAGATTTCTTCGTTCCACTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-253s21c1
Sequence:CCGGTAAGGCAGATTACGTACATAACTCGAGTTATGTACGTAATCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-381s21c1
Sequence:CCGGTCGGCCACATCTCCTACTTTGCTCGAGCAAAGTAGGAGATGTGGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029799.1-478s21c1
Sequence:CCGGGTTCCGCCAGAGGAATCTAAGCTCGAGCTTAGATTCCTCTGGCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks