EMAIL THIS PAGE TO A FRIEND

ARSB

arylsulfatase B

105 Gene Product Result for
Synonyms: ASB G4S MPS6
UniProtKB ID: P15848, B2RC20, Q8N322, Q9UDI9
Gene ID:
Human(411) Summary: Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targetted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11881) arylsulfatase B
Rat(25227) arylsulfatase B
naked mole-rat(101719731) arylsulfatase B
sheep(101108314) arylsulfatase B
chicken(771459) arylsulfatase B
domestic cat(100216331) arylsulfatase B
cow(538401) arylsulfatase B
dog(610364) arylsulfatase B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000046 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000046 Rosetta Predictions human pricing
NM_198709 Rosetta Predictions human pricing
NM_033443 Rosetta Predictions rat pricing
NM_009712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301738 predicted 1747
2 SASI_Hs01_00032919 predicted 1876
3 SASI_Hs01_00032920 predicted 2088
4 SASI_Hs01_00032922 predicted 1784
5 SASI_Hs01_00032923 predicted 1789
6 SASI_Hs01_00032924 predicted 2062
7 SASI_Hs01_00032925 predicted 1848
8 SASI_Hs01_00032926 predicted 2062
9 SASI_Hs02_00301739 predicted 1634
10 SASI_Hs01_00032928 predicted 1738
11 SASI_Hs01_00032921 predicted 1644
12 SASI_Hs01_00032927 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372294 predicted 818
2 SASI_Hs01_00220842 predicted 948
3 SASI_Hs01_00220843 predicted 1159
4 SASI_Hs01_00220845 predicted 853
5 SASI_Hs01_00220846 predicted 858
6 SASI_Hs01_00220847 predicted 1140
7 SASI_Hs01_00220848 predicted 923
8 SASI_Hs01_00220849 predicted 1132
9 SASI_Hs02_00372295 predicted 711
10 SASI_Hs01_00220851 predicted 802
11 SASI_Hs01_00220844 predicted 716
12 SASI_Hs01_00220850 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104267 predicted 727
2 SASI_Rn01_00104268 predicted 395
3 SASI_Rn01_00104269 predicted 832
4 SASI_Rn01_00104270 predicted 939
5 SASI_Rn01_00104271 predicted 1600
6 SASI_Rn01_00104272 predicted 439
7 SASI_Rn02_00265557 predicted 1564
8 SASI_Rn01_00104273 predicted 1528
9 SASI_Rn01_00104274 predicted 688
10 SASI_Rn01_00104276 predicted 627
11 SASI_Rn01_00104275 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154914 predicted 1278
2 SASI_Mm02_00316859 predicted 417
3 SASI_Mm01_00154915 predicted 749
4 SASI_Mm01_00154916 predicted 851
5 SASI_Mm01_00154917 predicted 1357
6 SASI_Mm01_00154919 predicted 1601
7 SASI_Mm01_00154920 predicted 966
8 SASI_Mm01_00154922 predicted 1359
9 SASI_Mm01_00154923 predicted 712
10 SASI_Mm02_00316860 predicted 875
11 SASI_Mm01_00154918 predicted 474
12 SASI_Mm01_00154921 predicted 1292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009712
VALIDATED
ARSB MISSION shRNA Bacterial Glycerol Stock
arylsulfatase B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-860s1c1
Sequence:CCGGCCAAGATAAGCACAGACGTATCTCGAGATACGTCTGTGCTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009712.1-2680s1c1
Sequence:CCGGCCCAGAGTAATAGTTTCAAATCTCGAGATTTGAAACTATTACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-630s1c1
Sequence:CCGGGCGCCGATTGAGTCTTTGAATCTCGAGATTCAAAGACTCAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-563s1c1
Sequence:CCGGCCGAGGATTCGATACCTACTTCTCGAGAAGTAGGTATCGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-861s1c1
Sequence:CCGGCAAGATAAGCACAGACGTATTCTCGAGAATACGTCTGTGCTTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009712
VALIDATED
ARSB MISSION shRNA shRNA Plasmid DNA
arylsulfatase B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-860s1c1
Sequence:CCGGCCAAGATAAGCACAGACGTATCTCGAGATACGTCTGTGCTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009712.1-2680s1c1
Sequence:CCGGCCCAGAGTAATAGTTTCAAATCTCGAGATTTGAAACTATTACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-630s1c1
Sequence:CCGGGCGCCGATTGAGTCTTTGAATCTCGAGATTCAAAGACTCAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-563s1c1
Sequence:CCGGCCGAGGATTCGATACCTACTTCTCGAGAAGTAGGTATCGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-861s1c1
Sequence:CCGGCAAGATAAGCACAGACGTATTCTCGAGAATACGTCTGTGCTTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009712
VALIDATED
ARSB MISSION shRNA Lentiviral Transduction Particles
arylsulfatase B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-860s1c1
Sequence:CCGGCCAAGATAAGCACAGACGTATCTCGAGATACGTCTGTGCTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009712.1-2680s1c1
Sequence:CCGGCCCAGAGTAATAGTTTCAAATCTCGAGATTTGAAACTATTACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-630s1c1
Sequence:CCGGGCGCCGATTGAGTCTTTGAATCTCGAGATTCAAAGACTCAATCGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-563s1c1
Sequence:CCGGCCGAGGATTCGATACCTACTTCTCGAGAAGTAGGTATCGAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009712.1-861s1c1
Sequence:CCGGCAAGATAAGCACAGACGTATTCTCGAGAATACGTCTGTGCTTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000046
VALIDATED
ARSB MISSION shRNA Bacterial Glycerol Stock
arylsulfatase B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-2787s1c1
Sequence:CCGGCGCCTACAGTTCTACCATAAACTCGAGTTTATGGTAGAACTGTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-2643s1c1
Sequence:CCGGCCACCGTCTCAATACAATGTTCTCGAGAACATTGTATTGAGACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000046.2-2459s1c1
Sequence:CCGGGCTGCATAATATTGACCCGAACTCGAGTTCGGGTCAATATTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-1645s1c1
Sequence:CCGGGCTGTGTTCCTCTGGATGAAACTCGAGTTTCATCCAGAGGAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-1763s1c1
Sequence:CCGGCCGAGGATTTGATACCTACTTCTCGAGAAGTAGGTATCAAATCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-1645s21c1
Sequence:CCGGGCTGTGTTCCTCTGGATGAAACTCGAGTTTCATCCAGAGGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-2643s21c1
Sequence:CCGGCCACCGTCTCAATACAATGTTCTCGAGAACATTGTATTGAGACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-2787s21c1
Sequence:CCGGCGCCTACAGTTCTACCATAAACTCGAGTTTATGGTAGAACTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-1763s21c1
Sequence:CCGGCCGAGGATTTGATACCTACTTCTCGAGAAGTAGGTATCAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000046
VALIDATED
ARSB MISSION shRNA shRNA Plasmid DNA
arylsulfatase B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-2787s1c1
Sequence:CCGGCGCCTACAGTTCTACCATAAACTCGAGTTTATGGTAGAACTGTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-2643s1c1
Sequence:CCGGCCACCGTCTCAATACAATGTTCTCGAGAACATTGTATTGAGACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000046.2-2459s1c1
Sequence:CCGGGCTGCATAATATTGACCCGAACTCGAGTTCGGGTCAATATTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-1645s1c1
Sequence:CCGGGCTGTGTTCCTCTGGATGAAACTCGAGTTTCATCCAGAGGAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-1763s1c1
Sequence:CCGGCCGAGGATTTGATACCTACTTCTCGAGAAGTAGGTATCAAATCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-1645s21c1
Sequence:CCGGGCTGTGTTCCTCTGGATGAAACTCGAGTTTCATCCAGAGGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-2643s21c1
Sequence:CCGGCCACCGTCTCAATACAATGTTCTCGAGAACATTGTATTGAGACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-2787s21c1
Sequence:CCGGCGCCTACAGTTCTACCATAAACTCGAGTTTATGGTAGAACTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-1763s21c1
Sequence:CCGGCCGAGGATTTGATACCTACTTCTCGAGAAGTAGGTATCAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000046
VALIDATED
ARSB MISSION shRNA Lentiviral Transduction Particles
arylsulfatase B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-2787s1c1
Sequence:CCGGCGCCTACAGTTCTACCATAAACTCGAGTTTATGGTAGAACTGTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-2643s1c1
Sequence:CCGGCCACCGTCTCAATACAATGTTCTCGAGAACATTGTATTGAGACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000046.2-2459s1c1
Sequence:CCGGGCTGCATAATATTGACCCGAACTCGAGTTCGGGTCAATATTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-1645s1c1
Sequence:CCGGGCTGTGTTCCTCTGGATGAAACTCGAGTTTCATCCAGAGGAACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000046.2-1763s1c1
Sequence:CCGGCCGAGGATTTGATACCTACTTCTCGAGAAGTAGGTATCAAATCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-1645s21c1
Sequence:CCGGGCTGTGTTCCTCTGGATGAAACTCGAGTTTCATCCAGAGGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-2643s21c1
Sequence:CCGGCCACCGTCTCAATACAATGTTCTCGAGAACATTGTATTGAGACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-2787s21c1
Sequence:CCGGCGCCTACAGTTCTACCATAAACTCGAGTTTATGGTAGAACTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000046.3-1763s21c1
Sequence:CCGGCCGAGGATTTGATACCTACTTCTCGAGAAGTAGGTATCAAATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks