EMAIL THIS PAGE TO A FRIEND

ARSD

arylsulfatase D

38 Gene Product Result for
Synonyms: ASD
UniProtKB ID: P51689, Q9UHJ8
Gene ID:
Human(414) Summary: The protein encoded by this gene is a member of the sulfatase family. Sulfatases are essential for the correct composition of bone and cartilage matrix. The encoded protein is postranslationally glycosylated and localized to the lysosome. This gene is located within a cluster of similar arylsulfatase genes on chromosome X. A related pseudogene has been identified in the pseudoautosomal region of chromosome Y. [provided by RefSeq, Jul 2011]
chicken(418658) arylsulfatase D
cow(516494) arylsulfatase D
domestic cat(101081194) arylsulfatase D
dog(491718) arylsulfatase D
sheep(101116024) arylsulfatase D
naked mole-rat(101698961) arylsulfatase D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001669 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065581 MISSION® esiRNA esiRNA human ARSD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001669 Rosetta Predictions human pricing
NM_009589 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116825 predicted 598
2 SASI_Hs01_00116826 predicted 725
3 SASI_Hs01_00116827 predicted 829
4 SASI_Hs02_00332302 predicted 402
5 SASI_Hs01_00116829 predicted 573
6 SASI_Hs02_00332303 predicted 478
7 SASI_Hs01_00116831 predicted 492
8 SASI_Hs01_00116832 predicted 493
9 SASI_Hs01_00116834 predicted 801
10 SASI_Hs02_00332304 predicted 835
11 SASI_Hs01_00116828 predicted 807
12 SASI_Hs01_00116830 predicted 391
13 SASI_Hs01_00116833 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045722 predicted 604
2 SASI_Hs01_00045723 predicted 724
3 SASI_Hs01_00045724 predicted 832
4 SASI_Hs02_00343517 predicted 397
5 SASI_Hs01_00045726 predicted 569
6 SASI_Hs02_00343518 predicted 480
7 SASI_Hs01_00045728 predicted 492
8 SASI_Hs01_00045729 predicted 490
9 SASI_Hs01_00045731 predicted 798
10 SASI_Hs02_00343519 predicted 833
11 SASI_Hs01_00045725 predicted 809
12 SASI_Hs01_00045727 predicted 395
13 SASI_Hs01_00045730 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001669
ARSD MISSION shRNA Bacterial Glycerol Stock
arylsulfatase D
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-262s21c1
Sequence:CCGGTACACTGAGAACGCCGAATATCTCGAGATATTCGGCGTTCTCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-896s21c1
Sequence:CCGGACAGCGAGTCTTATGCTAAAGCTCGAGCTTTAGCATAAGACTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-158s21c1
Sequence:CCGGCTGAAGACGTGTGAACCTAAACTCGAGTTTAGGTTCACACGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-1114s21c1
Sequence:CCGGGAACTCAACATTCACGTATTTCTCGAGAAATACGTGAATGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1091s1c1
Sequence:CCGGGCCATCGAAGACAATGGTTTACTCGAGTAAACCATTGTCTTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1069s1c1
Sequence:CCGGGCTCATAGGTAAGGTTCTTAACTCGAGTTAAGAACCTTACCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-473s1c1
Sequence:CCGGGCAAGAATCTTGCAGCAGCATCTCGAGATGCTGCTGCAAGATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-577s1c1
Sequence:CCGGCCACGGATTTGACTATTTCTACTCGAGTAGAAATAGTCAAATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1430s1c1
Sequence:CCGGGCACATGAGTTCCTGTTTCATCTCGAGATGAAACAGGAACTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001669
ARSD MISSION shRNA shRNA Plasmid DNA
arylsulfatase D
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-262s21c1
Sequence:CCGGTACACTGAGAACGCCGAATATCTCGAGATATTCGGCGTTCTCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-896s21c1
Sequence:CCGGACAGCGAGTCTTATGCTAAAGCTCGAGCTTTAGCATAAGACTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-158s21c1
Sequence:CCGGCTGAAGACGTGTGAACCTAAACTCGAGTTTAGGTTCACACGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-1114s21c1
Sequence:CCGGGAACTCAACATTCACGTATTTCTCGAGAAATACGTGAATGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1091s1c1
Sequence:CCGGGCCATCGAAGACAATGGTTTACTCGAGTAAACCATTGTCTTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1069s1c1
Sequence:CCGGGCTCATAGGTAAGGTTCTTAACTCGAGTTAAGAACCTTACCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-473s1c1
Sequence:CCGGGCAAGAATCTTGCAGCAGCATCTCGAGATGCTGCTGCAAGATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-577s1c1
Sequence:CCGGCCACGGATTTGACTATTTCTACTCGAGTAGAAATAGTCAAATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1430s1c1
Sequence:CCGGGCACATGAGTTCCTGTTTCATCTCGAGATGAAACAGGAACTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001669
ARSD MISSION shRNA Lentiviral Transduction Particles
arylsulfatase D
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-262s21c1
Sequence:CCGGTACACTGAGAACGCCGAATATCTCGAGATATTCGGCGTTCTCAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-896s21c1
Sequence:CCGGACAGCGAGTCTTATGCTAAAGCTCGAGCTTTAGCATAAGACTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-158s21c1
Sequence:CCGGCTGAAGACGTGTGAACCTAAACTCGAGTTTAGGTTCACACGTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001669.2-1114s21c1
Sequence:CCGGGAACTCAACATTCACGTATTTCTCGAGAAATACGTGAATGTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1091s1c1
Sequence:CCGGGCCATCGAAGACAATGGTTTACTCGAGTAAACCATTGTCTTCGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1069s1c1
Sequence:CCGGGCTCATAGGTAAGGTTCTTAACTCGAGTTAAGAACCTTACCTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-473s1c1
Sequence:CCGGGCAAGAATCTTGCAGCAGCATCTCGAGATGCTGCTGCAAGATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-577s1c1
Sequence:CCGGCCACGGATTTGACTATTTCTACTCGAGTAGAAATAGTCAAATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001669.1-1430s1c1
Sequence:CCGGGCACATGAGTTCCTGTTTCATCTCGAGATGAAACAGGAACTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks