EMAIL THIS PAGE TO A FRIEND

ARSE

arylsulfatase E (chondrodysplasia punctata 1)

39 Gene Product Result for
Synonyms: ASE CDPX CDPX1 CDPXR
UniProtKB ID: P51690, Q53FT2, Q53FU8
Gene ID:
Human(415) Summary: Arylsulfatase E is a member of the sulfatase family. It is glycosylated postranslationally and localized to the golgi apparatus. Sulfatases are essential for the correct composition of bone and cartilage matrix. X-linked chondrodysplasia punctata, a disease characterized by abnormalities in cartilage and bone development, has been linked to mutations in this gene. [provided by RefSeq, Jul 2008]
Rat(310326) arylsulfatase E (chondrodysplasia punctata 1)
chicken(418659) arylsulfatase E (chondrodysplasia punctata 1)
domestic cat(101081445) arylsulfatase E (chondrodysplasia punctata 1)
Horse(100064693) arylsulfatase E (chondrodysplasia punctata 1)
cow(505899) arylsulfatase E (chondrodysplasia punctata 1)
dog(491719) arylsulfatase E (chondrodysplasia punctata 1)
naked mole-rat(101710316) arylsulfatase E (chondrodysplasia punctata 1)
domestic guinea pig(100719165) arylsulfatase E (chondrodysplasia punctata 1)
sheep(101115759) arylsulfatase E (chondrodysplasia punctata 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000047 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061901 MISSION® esiRNA esiRNA human ARSE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000047 Rosetta Predictions human pricing
NM_001047885 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084459 predicted 923
2 SASI_Hs01_00084460 predicted 983
3 SASI_Hs02_00301740 predicted 1148
4 SASI_Hs01_00084461 predicted 1169
5 SASI_Hs01_00084462 predicted 569
6 SASI_Hs02_00301741 predicted 746
7 SASI_Hs01_00084465 predicted 1533
8 SASI_Hs02_00301742 predicted 731
9 SASI_Hs01_00084467 predicted 754
10 SASI_Hs01_00084468 predicted 533
11 SASI_Hs01_00084463 predicted 567
12 SASI_Hs01_00084464 predicted 940
13 SASI_Hs01_00084466 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206487 predicted 753
2 SASI_Rn02_00206488 predicted 911
3 SASI_Rn02_00206489 predicted 277
4 SASI_Rn02_00206490 predicted 1281
5 SASI_Rn02_00206491 predicted 1422
6 SASI_Rn02_00206492 predicted 1227
7 SASI_Rn02_00206493 predicted 360
8 SASI_Rn02_00206494 predicted 989
9 SASI_Rn02_00206495 predicted 711
10 SASI_Rn02_00206496 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000047
ARSE MISSION shRNA Bacterial Glycerol Stock
arylsulfatase E (chondrodysplasia punctata 1)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-819s1c1
Sequence:CCGGCCGATTGCTTTCTGATGAGAACTCGAGTTCTCATCAGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-1138s1c1
Sequence:CCGGCCTAGAGAATCAACTTGGAAACTCGAGTTTCCAAGTTGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-121s1c1
Sequence:CCGGGCTCGCTGTACTGCTAAGTTTCTCGAGAAACTTAGCAGTACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-973s1c1
Sequence:CCGGCCCTCTTATCACTATGGAGAACTCGAGTTCTCCATAGTGATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-587s1c1
Sequence:CCGGCCTTTCTCCTTGATGGGTGATCTCGAGATCACCCATCAAGGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-304s21c1
Sequence:CCGGGCTCGCTGTACTGCTAAGTTTCTCGAGAAACTTAGCAGTACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-770s21c1
Sequence:CCGGCCTTTCTCCTTGATGGGTGATCTCGAGATCACCCATCAAGGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-1321s21c1
Sequence:CCGGCCTAGAGAATCAACTTGGAAACTCGAGTTTCCAAGTTGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-1002s21c1
Sequence:CCGGCCGATTGCTTTCTGATGAGAACTCGAGTTCTCATCAGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000047
ARSE MISSION shRNA shRNA Plasmid DNA
arylsulfatase E (chondrodysplasia punctata 1)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-819s1c1
Sequence:CCGGCCGATTGCTTTCTGATGAGAACTCGAGTTCTCATCAGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-1138s1c1
Sequence:CCGGCCTAGAGAATCAACTTGGAAACTCGAGTTTCCAAGTTGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-121s1c1
Sequence:CCGGGCTCGCTGTACTGCTAAGTTTCTCGAGAAACTTAGCAGTACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-973s1c1
Sequence:CCGGCCCTCTTATCACTATGGAGAACTCGAGTTCTCCATAGTGATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-587s1c1
Sequence:CCGGCCTTTCTCCTTGATGGGTGATCTCGAGATCACCCATCAAGGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-304s21c1
Sequence:CCGGGCTCGCTGTACTGCTAAGTTTCTCGAGAAACTTAGCAGTACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-770s21c1
Sequence:CCGGCCTTTCTCCTTGATGGGTGATCTCGAGATCACCCATCAAGGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-1321s21c1
Sequence:CCGGCCTAGAGAATCAACTTGGAAACTCGAGTTTCCAAGTTGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-1002s21c1
Sequence:CCGGCCGATTGCTTTCTGATGAGAACTCGAGTTCTCATCAGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000047
ARSE MISSION shRNA Lentiviral Transduction Particles
arylsulfatase E (chondrodysplasia punctata 1)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-819s1c1
Sequence:CCGGCCGATTGCTTTCTGATGAGAACTCGAGTTCTCATCAGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-1138s1c1
Sequence:CCGGCCTAGAGAATCAACTTGGAAACTCGAGTTTCCAAGTTGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-121s1c1
Sequence:CCGGGCTCGCTGTACTGCTAAGTTTCTCGAGAAACTTAGCAGTACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-973s1c1
Sequence:CCGGCCCTCTTATCACTATGGAGAACTCGAGTTCTCCATAGTGATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000047.1-587s1c1
Sequence:CCGGCCTTTCTCCTTGATGGGTGATCTCGAGATCACCCATCAAGGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-304s21c1
Sequence:CCGGGCTCGCTGTACTGCTAAGTTTCTCGAGAAACTTAGCAGTACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-770s21c1
Sequence:CCGGCCTTTCTCCTTGATGGGTGATCTCGAGATCACCCATCAAGGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-1321s21c1
Sequence:CCGGCCTAGAGAATCAACTTGGAAACTCGAGTTTCCAAGTTGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000047.2-1002s21c1
Sequence:CCGGCCGATTGCTTTCTGATGAGAACTCGAGTTCTCATCAGAAAGCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks