EMAIL THIS PAGE TO A FRIEND

ARSF

arylsulfatase F

22 Gene Product Result for
Synonyms: ASF
UniProtKB ID: P54793, Q8TCC5
Gene ID:
Human(416) Summary: This gene is a member of the sulfatase family, and more specifically, the arylsulfatase subfamily. Members of the subfamily share similarity in sequence and splice sites, and are clustered together on chromosome X, suggesting that they are derived from recent gene duplication events. Sulfatases are essential for the correct composition of bone and cartilage matrix. The activity of this protein, unlike that of arylsulfatase E, is not inhibited by warfarin. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jan 2011]
dog(609908) arylsulfatase F
Horse(100064771) arylsulfatase F
domestic cat(101081704) arylsulfatase F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004042 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074501 MISSION® esiRNA esiRNA human ARSF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004042 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059546 predicted 1092
2 SASI_Hs01_00059547 predicted 367
3 SASI_Hs01_00059548 predicted 626
4 SASI_Hs02_00336792 predicted 1060
5 SASI_Hs01_00059549 predicted 1282
6 SASI_Hs02_00336793 predicted 873
7 SASI_Hs01_00059551 predicted 887
8 SASI_Hs01_00059552 predicted 426
9 SASI_Hs01_00059553 predicted 1157
10 SASI_Hs01_00059554 predicted 383
11 SASI_Hs01_00059550 predicted 1176
12 SASI_Hs01_00059555 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004042
ARSF MISSION shRNA Bacterial Glycerol Stock
arylsulfatase F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-536s21c1
Sequence:CCGGCCAGTGCCACCATCCATATAACTCGAGTTATATGGATGGTGGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-1064s21c1
Sequence:CCGGTCTTGATGCTATCGATGATTTCTCGAGAAATCATCGATAGCATCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-870s21c1
Sequence:CCGGGAACGAGCTGGATCCATTATGCTCGAGCATAATGGATCCAGCTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-361s1c1
Sequence:CCGGCCATCCGATCAGGTATGGTTTCTCGAGAAACCATACCTGATCGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-432s1c1
Sequence:CCGGCCTCTTAATGAGACAACACTTCTCGAGAAGTGTTGTCTCATTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-1540s1c1
Sequence:CCGGGCTGCTATGTCACCTCATTATCTCGAGATAATGAGGTGACATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-1104s1c1
Sequence:CCGGCTTGTCTACTTTACATCAGATCTCGAGATCTGATGTAAAGTAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-176s1c1
Sequence:CCGGGCCTAATATTGTCCTAATCATCTCGAGATGATTAGGACAATATTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004042
ARSF MISSION shRNA shRNA Plasmid DNA
arylsulfatase F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-536s21c1
Sequence:CCGGCCAGTGCCACCATCCATATAACTCGAGTTATATGGATGGTGGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-1064s21c1
Sequence:CCGGTCTTGATGCTATCGATGATTTCTCGAGAAATCATCGATAGCATCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-870s21c1
Sequence:CCGGGAACGAGCTGGATCCATTATGCTCGAGCATAATGGATCCAGCTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-361s1c1
Sequence:CCGGCCATCCGATCAGGTATGGTTTCTCGAGAAACCATACCTGATCGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-432s1c1
Sequence:CCGGCCTCTTAATGAGACAACACTTCTCGAGAAGTGTTGTCTCATTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-1540s1c1
Sequence:CCGGGCTGCTATGTCACCTCATTATCTCGAGATAATGAGGTGACATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-1104s1c1
Sequence:CCGGCTTGTCTACTTTACATCAGATCTCGAGATCTGATGTAAAGTAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-176s1c1
Sequence:CCGGGCCTAATATTGTCCTAATCATCTCGAGATGATTAGGACAATATTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004042
ARSF MISSION shRNA Lentiviral Transduction Particles
arylsulfatase F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-536s21c1
Sequence:CCGGCCAGTGCCACCATCCATATAACTCGAGTTATATGGATGGTGGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-1064s21c1
Sequence:CCGGTCTTGATGCTATCGATGATTTCTCGAGAAATCATCGATAGCATCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004042.3-870s21c1
Sequence:CCGGGAACGAGCTGGATCCATTATGCTCGAGCATAATGGATCCAGCTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-361s1c1
Sequence:CCGGCCATCCGATCAGGTATGGTTTCTCGAGAAACCATACCTGATCGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-432s1c1
Sequence:CCGGCCTCTTAATGAGACAACACTTCTCGAGAAGTGTTGTCTCATTAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-1540s1c1
Sequence:CCGGGCTGCTATGTCACCTCATTATCTCGAGATAATGAGGTGACATAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-1104s1c1
Sequence:CCGGCTTGTCTACTTTACATCAGATCTCGAGATCTGATGTAAAGTAGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004042.3-176s1c1
Sequence:CCGGGCCTAATATTGTCCTAATCATCTCGAGATGATTAGGACAATATTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)