EMAIL THIS PAGE TO A FRIEND

ARSG

arylsulfatase G

UniProtKB ID: Q96EG1, Q6UXF2, Q9Y2K4
Gene ID:
Human(22901) Summary: The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(74008) arylsulfatase G
Rat(303631) arylsulfatase G
Zebrafish(564790) arylsulfatase G
dog(480460) arylsulfatase G
domestic cat(101093311) arylsulfatase G
cow(100298177) arylsulfatase G
cow(513067) arylsulfatase G
chicken(427811) arylsulfatase G
sheep(101109286) arylsulfatase G
naked mole-rat(101720783) arylsulfatase G
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014960 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014960 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014960 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014960 Rosetta Predictions human pricing
NM_001047877 Rosetta Predictions rat pricing
NM_028710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346644 predicted 597
2 SASI_Hs01_00043121 predicted 1317
3 SASI_Hs01_00043123 predicted 1380
4 SASI_Hs02_00346645 predicted 527
5 SASI_Hs01_00043127 predicted 248
6 SASI_Hs02_00346646 predicted 721
7 SASI_Hs02_00346647 predicted 700
8 SASI_Hs02_00346648 predicted 533
9 SASI_Hs02_00346649 predicted 1509
10 SASI_Hs02_00346650 predicted 347
11 SASI_Hs01_00043119 predicted 330
12 SASI_Hs01_00043120 predicted 222
13 SASI_Hs01_00043122 predicted 252
14 SASI_Hs01_00043124 predicted 1550
15 SASI_Hs01_00043125 predicted 1076
16 SASI_Hs01_00043126 predicted 1317
17 SASI_Hs01_00043128 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206407 predicted 954
2 SASI_Rn02_00206408 predicted 1279
3 SASI_Rn02_00206409 predicted 747
4 SASI_Rn02_00206410 predicted 636
5 SASI_Rn02_00206411 predicted 211
6 SASI_Rn02_00206412 predicted 487
7 SASI_Rn02_00206413 predicted 434
8 SASI_Rn02_00206414 predicted 803
9 SASI_Rn02_00206415 predicted 1080
10 SASI_Rn02_00206416 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191722 predicted 2166
2 SASI_Mm01_00191723 predicted 1932
3 SASI_Mm01_00191724 predicted 1613
4 SASI_Mm01_00191725 predicted 762
5 SASI_Mm01_00191726 predicted 1697
6 SASI_Mm01_00191727 predicted 1824
7 SASI_Mm01_00191728 predicted 1404
8 SASI_Mm02_00334247 predicted 2008
9 SASI_Mm01_00191729 predicted 996
10 SASI_Mm01_00191730 predicted 1184
11 SASI_Mm01_00191731 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014960
ARSG MISSION shRNA Bacterial Glycerol Stock
arylsulfatase G
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-1571s1c1
Sequence:CCGGCCTGCTGTAATCCCTACCAAACTCGAGTTTGGTAGGGATTACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-1383s1c1
Sequence:CCGGGCAGCATAAGTTTCCTCTGATCTCGAGATCAGAGGAAACTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-927s1c1
Sequence:CCGGCCTCTGGTTTACAGGAGACAACTCGAGTTGTCTCCTGTAAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-347s1c1
Sequence:CCGGCACGCAACTTTGCAGTCACTTCTCGAGAAGTGACTGCAAAGTTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-224s1c1
Sequence:CCGGCCAACCTTGATAAGATGGCTTCTCGAGAAGCCATCTTATCAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1182s21c1
Sequence:CCGGGTTACGTCACTGGGATAATAGCTCGAGCTATTATCCCAGTGACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1261s21c1
Sequence:CCGGCTACTTTGGAATCCCATATAGCTCGAGCTATATGGGATTCCAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1095s21c1
Sequence:CCGGATGGAGTCACACGCAACTTTGCTCGAGCAAAGTTGCGTGTGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-2284s21c1
Sequence:CCGGCAACATCTCCAGCGCAGATTACTCGAGTAATCTGCGCTGGAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014960
ARSG MISSION shRNA shRNA Plasmid DNA
arylsulfatase G
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-1571s1c1
Sequence:CCGGCCTGCTGTAATCCCTACCAAACTCGAGTTTGGTAGGGATTACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-1383s1c1
Sequence:CCGGGCAGCATAAGTTTCCTCTGATCTCGAGATCAGAGGAAACTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-927s1c1
Sequence:CCGGCCTCTGGTTTACAGGAGACAACTCGAGTTGTCTCCTGTAAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-347s1c1
Sequence:CCGGCACGCAACTTTGCAGTCACTTCTCGAGAAGTGACTGCAAAGTTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-224s1c1
Sequence:CCGGCCAACCTTGATAAGATGGCTTCTCGAGAAGCCATCTTATCAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1182s21c1
Sequence:CCGGGTTACGTCACTGGGATAATAGCTCGAGCTATTATCCCAGTGACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1261s21c1
Sequence:CCGGCTACTTTGGAATCCCATATAGCTCGAGCTATATGGGATTCCAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1095s21c1
Sequence:CCGGATGGAGTCACACGCAACTTTGCTCGAGCAAAGTTGCGTGTGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-2284s21c1
Sequence:CCGGCAACATCTCCAGCGCAGATTACTCGAGTAATCTGCGCTGGAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014960
ARSG MISSION shRNA Lentiviral Transduction Particles
arylsulfatase G
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-1571s1c1
Sequence:CCGGCCTGCTGTAATCCCTACCAAACTCGAGTTTGGTAGGGATTACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-1383s1c1
Sequence:CCGGGCAGCATAAGTTTCCTCTGATCTCGAGATCAGAGGAAACTTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-927s1c1
Sequence:CCGGCCTCTGGTTTACAGGAGACAACTCGAGTTGTCTCCTGTAAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-347s1c1
Sequence:CCGGCACGCAACTTTGCAGTCACTTCTCGAGAAGTGACTGCAAAGTTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014960.2-224s1c1
Sequence:CCGGCCAACCTTGATAAGATGGCTTCTCGAGAAGCCATCTTATCAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1182s21c1
Sequence:CCGGGTTACGTCACTGGGATAATAGCTCGAGCTATTATCCCAGTGACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1261s21c1
Sequence:CCGGCTACTTTGGAATCCCATATAGCTCGAGCTATATGGGATTCCAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-1095s21c1
Sequence:CCGGATGGAGTCACACGCAACTTTGCTCGAGCAAAGTTGCGTGTGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014960.3-2284s21c1
Sequence:CCGGCAACATCTCCAGCGCAGATTACTCGAGTAATCTGCGCTGGAGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028710
VALIDATED
ARSG MISSION shRNA Bacterial Glycerol Stock
arylsulfatase G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-2398s1c1
Sequence:CCGGGCAATGCCTTAAACCTCAATTCTCGAGAATTGAGGTTTAAGGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-1703s1c1
Sequence:CCGGCGGAAATTTGATGGACGGGATCTCGAGATCCCGTCCATCAAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028710.2-623s1c1
Sequence:CCGGGATTTCTCTATCAGTGGGAAACTCGAGTTTCCCACTGATAGAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028710.2-2097s1c1
Sequence:CCGGCCTATCAAACTACCTGCCGTTCTCGAGAACGGCAGGTAGTTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-1004s1c1
Sequence:CCGGCGTGGCTTCGATTACTACTTTCTCGAGAAAGTAGTAATCGAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028710
VALIDATED
ARSG MISSION shRNA shRNA Plasmid DNA
arylsulfatase G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-2398s1c1
Sequence:CCGGGCAATGCCTTAAACCTCAATTCTCGAGAATTGAGGTTTAAGGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-1703s1c1
Sequence:CCGGCGGAAATTTGATGGACGGGATCTCGAGATCCCGTCCATCAAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028710.2-623s1c1
Sequence:CCGGGATTTCTCTATCAGTGGGAAACTCGAGTTTCCCACTGATAGAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028710.2-2097s1c1
Sequence:CCGGCCTATCAAACTACCTGCCGTTCTCGAGAACGGCAGGTAGTTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-1004s1c1
Sequence:CCGGCGTGGCTTCGATTACTACTTTCTCGAGAAAGTAGTAATCGAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028710
VALIDATED
ARSG MISSION shRNA Lentiviral Transduction Particles
arylsulfatase G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-2398s1c1
Sequence:CCGGGCAATGCCTTAAACCTCAATTCTCGAGAATTGAGGTTTAAGGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-1703s1c1
Sequence:CCGGCGGAAATTTGATGGACGGGATCTCGAGATCCCGTCCATCAAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028710.2-623s1c1
Sequence:CCGGGATTTCTCTATCAGTGGGAAACTCGAGTTTCCCACTGATAGAGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028710.2-2097s1c1
Sequence:CCGGCCTATCAAACTACCTGCCGTTCTCGAGAACGGCAGGTAGTTTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028710.2-1004s1c1
Sequence:CCGGCGTGGCTTCGATTACTACTTTCTCGAGAAAGTAGTAATCGAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks