EMAIL THIS PAGE TO A FRIEND

ARSH

arylsulfatase family, member H

19 Gene Product Result for
Synonyms: sulfatase
UniProtKB ID: Q5FYA8
Gene ID:
Human(347527) Summary: Sulfatases, such as ARSH, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]
naked mole-rat(101699324) arylsulfatase family, member H
sheep(101116287) arylsulfatase family, member H
Zebrafish(100332997) arylsulfatase H
dog(491720) arylsulfatase family, member H
cow(100336572) arylsulfatase family, member H
domestic cat(101080429) arylsulfatase family, member H
chicken(378798) arylsulfatase family, member H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011719 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011719 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189599 predicted 1351
2 SASI_Hs01_00189600 predicted 645
3 SASI_Hs01_00189601 predicted 1028
4 SASI_Hs01_00189602 predicted 332
5 SASI_Hs01_00189603 predicted 669
6 SASI_Hs01_00189604 predicted 670
7 SASI_Hs01_00189605 predicted 1459
8 SASI_Hs01_00189606 predicted 1335
9 SASI_Hs01_00189607 predicted 1135
10 SASI_Hs02_00306034 predicted 1079
11 SASI_Hs01_00189598 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011719
ARSH MISSION shRNA Bacterial Glycerol Stock
arylsulfatase family, member H
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-368s1c1
Sequence:CCGGCCTCTCGGAATGATCACTGTTCTCGAGAACAGTGATCATTCCGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1133s1c1
Sequence:CCGGCCACCAGCTTAATGGACATCTCTCGAGAGATGTCCATTAAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-847s1c1
Sequence:CCGGCGCAGTAAATATGGCAGGTATCTCGAGATACCTGCCATATTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1385s1c1
Sequence:CCGGGCTATGGGAGTGGAATATGTTCTCGAGAACATATTCCACTCCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1339s1c1
Sequence:CCGGGCTCATTATGTGACTCCTAAACTCGAGTTTAGGAGTCACATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1489s1c1
Sequence:CCGGCCTGACAATGAGCCATTATTTCTCGAGAAATAATGGCTCATTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-369s1c1
Sequence:CCGGCTCTCGGAATGATCACTGTTACTCGAGTAACAGTGATCATTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1500s1c1
Sequence:CCGGGCCATTATTTGACTCCGTGATCTCGAGATCACGGAGTCAAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-629s1c1
Sequence:CCGGCCTGGTACTCTAGTTATGGATCTCGAGATCCATAACTAGAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-71s1c1
Sequence:CCGGGCTACGGTAATAACTCAGTGACTCGAGTCACTGAGTTATTACCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011719
ARSH MISSION shRNA shRNA Plasmid DNA
arylsulfatase family, member H
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-368s1c1
Sequence:CCGGCCTCTCGGAATGATCACTGTTCTCGAGAACAGTGATCATTCCGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1133s1c1
Sequence:CCGGCCACCAGCTTAATGGACATCTCTCGAGAGATGTCCATTAAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-847s1c1
Sequence:CCGGCGCAGTAAATATGGCAGGTATCTCGAGATACCTGCCATATTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1385s1c1
Sequence:CCGGGCTATGGGAGTGGAATATGTTCTCGAGAACATATTCCACTCCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1339s1c1
Sequence:CCGGGCTCATTATGTGACTCCTAAACTCGAGTTTAGGAGTCACATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1489s1c1
Sequence:CCGGCCTGACAATGAGCCATTATTTCTCGAGAAATAATGGCTCATTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-369s1c1
Sequence:CCGGCTCTCGGAATGATCACTGTTACTCGAGTAACAGTGATCATTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1500s1c1
Sequence:CCGGGCCATTATTTGACTCCGTGATCTCGAGATCACGGAGTCAAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-629s1c1
Sequence:CCGGCCTGGTACTCTAGTTATGGATCTCGAGATCCATAACTAGAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-71s1c1
Sequence:CCGGGCTACGGTAATAACTCAGTGACTCGAGTCACTGAGTTATTACCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011719
ARSH MISSION shRNA Lentiviral Transduction Particles
arylsulfatase family, member H
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-368s1c1
Sequence:CCGGCCTCTCGGAATGATCACTGTTCTCGAGAACAGTGATCATTCCGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1133s1c1
Sequence:CCGGCCACCAGCTTAATGGACATCTCTCGAGAGATGTCCATTAAGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-847s1c1
Sequence:CCGGCGCAGTAAATATGGCAGGTATCTCGAGATACCTGCCATATTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1385s1c1
Sequence:CCGGGCTATGGGAGTGGAATATGTTCTCGAGAACATATTCCACTCCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1339s1c1
Sequence:CCGGGCTCATTATGTGACTCCTAAACTCGAGTTTAGGAGTCACATAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1489s1c1
Sequence:CCGGCCTGACAATGAGCCATTATTTCTCGAGAAATAATGGCTCATTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-369s1c1
Sequence:CCGGCTCTCGGAATGATCACTGTTACTCGAGTAACAGTGATCATTCCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-1500s1c1
Sequence:CCGGGCCATTATTTGACTCCGTGATCTCGAGATCACGGAGTCAAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-629s1c1
Sequence:CCGGCCTGGTACTCTAGTTATGGATCTCGAGATCCATAACTAGAGTACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011719.1-71s1c1
Sequence:CCGGGCTACGGTAATAACTCAGTGACTCGAGTCACTGAGTTATTACCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks