EMAIL THIS PAGE TO A FRIEND

ARSI

arylsulfatase family, member I

48 Gene Product Result for
UniProtKB ID: Q5FYB1, A1L3B0, B3KV22, B7XD03
Gene ID:
Human(340075) Summary: Sulfatases (EC 3.1.5.6), such as ARSI, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]
Mouse(545260) arylsulfatase i
Rat(307404) arylsulfatase family, member I
chicken(427639) arylsulfatase family, member I
domestic cat(101086206) arylsulfatase family, member I
cow(540390) arylsulfatase family, member I
dog(489186) arylsulfatase family, member I
sheep(101110236) arylsulfatase family, member I
naked mole-rat(101723265) arylsulfatase family, member I
domestic guinea pig(100727336) arylsulfatase family, member I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001038499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001038499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001038499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156991 MISSION® esiRNA esiRNA human ARSI (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012301 Rosetta Predictions human pricing
NM_001047881 Rosetta Predictions rat pricing
NM_001038499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054872 predicted 1881
2 SASI_Hs01_00054873 predicted 1001
3 SASI_Hs02_00306073 predicted 1201
4 SASI_Hs01_00054874 predicted 1201
5 SASI_Hs02_00306074 predicted 1837
6 SASI_Hs01_00054876 predicted 1319
7 SASI_Hs01_00054877 predicted 1883
8 SASI_Hs01_00054878 predicted 1683
9 SASI_Hs01_00054880 predicted 1351
10 SASI_Hs01_00054881 predicted 1234
11 SASI_Hs01_00054875 predicted 1161
12 SASI_Hs01_00054879 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206447 predicted 1087
2 SASI_Rn02_00206448 predicted 731
3 SASI_Rn02_00206449 predicted 1108
4 SASI_Rn02_00206450 predicted 614
5 SASI_Rn02_00206451 predicted 760
6 SASI_Rn02_00206452 predicted 267
7 SASI_Rn02_00206453 predicted 436
8 SASI_Rn02_00206454 predicted 1243
9 SASI_Rn02_00206455 predicted 929
10 SASI_Rn02_00206456 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065204 predicted 240
2 SASI_Mm01_00065205 predicted 268
3 SASI_Mm01_00065206 predicted 1297
4 SASI_Mm02_00289593 predicted 788
5 SASI_Mm01_00065207 predicted 924
6 SASI_Mm01_00065208 predicted 1105
7 SASI_Mm01_00065209 predicted 242
8 SASI_Mm01_00065210 predicted 616
9 SASI_Mm01_00065211 predicted 326
10 SASI_Mm01_00065212 predicted 609
11 SASI_Mm01_00065213 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012301
ARSI MISSION shRNA Bacterial Glycerol Stock
arylsulfatase family, member I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-140s1c1
Sequence:CCGGCCCACATCATCTTCATCCTCACTCGAGTGAGGATGAAGATGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-255s1c1
Sequence:CCGGGAATTATTACATCCAGCCCATCTCGAGATGGGCTGGATGTAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-858s1c1
Sequence:CCGGCTACAACAACAGTGTCATCATCTCGAGATGATGACACTGTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-519s1c1
Sequence:CCGGCAATGTGGACTATTACACCTACTCGAGTAGGTGTAATAGTCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-873s1c1
Sequence:CCGGCATCATCTTCTCCAGTGACAACTCGAGTTGTCACTGGAGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-1479s1c1
Sequence:CCGGCGAATATAACCGCACAGCCATCTCGAGATGGCTGTGCGGTTATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-614s1c1
Sequence:CCGGGCCAGTACTCCACTATGCTTTCTCGAGAAAGCATAGTGGAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-1032s1c1
Sequence:CCGGGATGCACATCACTGACTGGTACTCGAGTACCAGTCAGTGATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-1167s1c1
Sequence:CCGGGCACAACATTGACCCACTCTACTCGAGTAGAGTGGGTCAATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012301
ARSI MISSION shRNA shRNA Plasmid DNA
arylsulfatase family, member I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-140s1c1
Sequence:CCGGCCCACATCATCTTCATCCTCACTCGAGTGAGGATGAAGATGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-255s1c1
Sequence:CCGGGAATTATTACATCCAGCCCATCTCGAGATGGGCTGGATGTAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-858s1c1
Sequence:CCGGCTACAACAACAGTGTCATCATCTCGAGATGATGACACTGTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-519s1c1
Sequence:CCGGCAATGTGGACTATTACACCTACTCGAGTAGGTGTAATAGTCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-873s1c1
Sequence:CCGGCATCATCTTCTCCAGTGACAACTCGAGTTGTCACTGGAGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-1479s1c1
Sequence:CCGGCGAATATAACCGCACAGCCATCTCGAGATGGCTGTGCGGTTATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-614s1c1
Sequence:CCGGGCCAGTACTCCACTATGCTTTCTCGAGAAAGCATAGTGGAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-1032s1c1
Sequence:CCGGGATGCACATCACTGACTGGTACTCGAGTACCAGTCAGTGATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-1167s1c1
Sequence:CCGGGCACAACATTGACCCACTCTACTCGAGTAGAGTGGGTCAATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012301
ARSI MISSION shRNA Lentiviral Transduction Particles
arylsulfatase family, member I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-140s1c1
Sequence:CCGGCCCACATCATCTTCATCCTCACTCGAGTGAGGATGAAGATGATGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-255s1c1
Sequence:CCGGGAATTATTACATCCAGCCCATCTCGAGATGGGCTGGATGTAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-858s1c1
Sequence:CCGGCTACAACAACAGTGTCATCATCTCGAGATGATGACACTGTTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-519s1c1
Sequence:CCGGCAATGTGGACTATTACACCTACTCGAGTAGGTGTAATAGTCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-873s1c1
Sequence:CCGGCATCATCTTCTCCAGTGACAACTCGAGTTGTCACTGGAGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-1479s1c1
Sequence:CCGGCGAATATAACCGCACAGCCATCTCGAGATGGCTGTGCGGTTATATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-614s1c1
Sequence:CCGGGCCAGTACTCCACTATGCTTTCTCGAGAAAGCATAGTGGAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012301.1-1032s1c1
Sequence:CCGGGATGCACATCACTGACTGGTACTCGAGTACCAGTCAGTGATGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012301.1-1167s1c1
Sequence:CCGGGCACAACATTGACCCACTCTACTCGAGTAGAGTGGGTCAATGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001038499
ARSI MISSION shRNA Bacterial Glycerol Stock
arylsulfatase family, member I
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000243671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-1467s21c1
Sequence:CCGGGGCTCGCCTGGCTGATTATAACTCGAGTTATAATCAGCCAGGCGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-842s21c1
Sequence:CCGGTCAAGCGCTATGGTTTCTATACTCGAGTATAGAAACCATAGCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-242s21c1
Sequence:CCGGGCGTCAAACTGGAGAATTATTCTCGAGAATAATTCTCCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-1377s21c1
Sequence:CCGGCCAGGCTGTGTGGCTCTTTAACTCGAGTTAAAGAGCCACACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001038499
ARSI MISSION shRNA shRNA Plasmid DNA
arylsulfatase family, member I
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000243671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-1467s21c1
Sequence:CCGGGGCTCGCCTGGCTGATTATAACTCGAGTTATAATCAGCCAGGCGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-842s21c1
Sequence:CCGGTCAAGCGCTATGGTTTCTATACTCGAGTATAGAAACCATAGCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-242s21c1
Sequence:CCGGGCGTCAAACTGGAGAATTATTCTCGAGAATAATTCTCCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-1377s21c1
Sequence:CCGGCCAGGCTGTGTGGCTCTTTAACTCGAGTTAAAGAGCCACACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001038499
ARSI MISSION shRNA Lentiviral Transduction Particles
arylsulfatase family, member I
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000243671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-1467s21c1
Sequence:CCGGGGCTCGCCTGGCTGATTATAACTCGAGTTATAATCAGCCAGGCGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-842s21c1
Sequence:CCGGTCAAGCGCTATGGTTTCTATACTCGAGTATAGAAACCATAGCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-242s21c1
Sequence:CCGGGCGTCAAACTGGAGAATTATTCTCGAGAATAATTCTCCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038499.1-1377s21c1
Sequence:CCGGCCAGGCTGTGTGGCTCTTTAACTCGAGTTAAAGAGCCACACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks