EMAIL THIS PAGE TO A FRIEND

ARSJ

arylsulfatase family, member J

93 Gene Product Result for
UniProtKB ID: Q5FYB0, A2RUG0, B7ZM45, Q1HA39, Q5FWE4, Q6UWT9
Gene ID:
Human(79642) Summary: Sulfatases (EC 3.1.5.6), such as ARSJ, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]
Mouse(271970) arylsulfatase J
Rat(311013) arylsulfatase family, member J
domestic guinea pig(100718105) arylsulfatase family, member J
naked mole-rat(101700778) arylsulfatase family, member J
sheep(101113591) arylsulfatase family, member J
Domestic Rabbit(100353192) arylsulfatase family, member J
chicken(422687) arylsulfatase family, member J
Horse(100072604) arylsulfatase family, member J
cow(540514) arylsulfatase family, member J
domestic cat(101099878) arylsulfatase family, member J
dog(487909) arylsulfatase family, member J
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024590 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032081 MISSION® esiRNA esiRNA human ARSJ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024590 Rosetta Predictions human pricing
NM_001047887 Rosetta Predictions rat pricing
NM_173451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138704 predicted 1807
2 SASI_Hs01_00138705 predicted 1786
3 SASI_Hs01_00138706 predicted 1303
4 SASI_Hs01_00138707 predicted 2065
5 SASI_Hs01_00138708 predicted 1615
6 SASI_Hs01_00138711 predicted 1574
7 SASI_Hs02_00356924 predicted 1050
8 SASI_Hs01_00138712 predicted 2099
9 SASI_Hs01_00138713 predicted 1236
10 SASI_Hs02_00356925 predicted 1958
11 SASI_Hs01_00138709 predicted 1927
12 SASI_Hs01_00138710 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206507 predicted 958
2 SASI_Rn02_00206508 predicted 369
3 SASI_Rn02_00206509 predicted 1439
4 SASI_Rn02_00206510 predicted 1021
5 SASI_Rn02_00206511 predicted 489
6 SASI_Rn02_00206512 predicted 902
7 SASI_Rn02_00206513 predicted 930
8 SASI_Rn02_00206514 predicted 1369
9 SASI_Rn02_00206515 predicted 268
10 SASI_Rn02_00206516 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098303 predicted 1523
2 SASI_Mm01_00098304 predicted 1878
3 SASI_Mm01_00098305 predicted 1171
4 SASI_Mm02_00345359 predicted 2362
5 SASI_Mm01_00098306 predicted 1412
6 SASI_Mm01_00098307 predicted 1365
7 SASI_Mm01_00098308 predicted 1852
8 SASI_Mm01_00098309 predicted 1153
9 SASI_Mm01_00098311 predicted 1182
10 SASI_Mm01_00098312 predicted 2110
11 SASI_Mm01_00098310 predicted 2032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173451
ARSJ MISSION shRNA Bacterial Glycerol Stock
arylsulfatase family, member J
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173451.1-3286s1c1
Sequence:CCGGCGGCAGATAGTGTCTGAACATCTCGAGATGTTCAGACACTATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-2187s1c1
Sequence:CCGGCCCATTTACACCAAGGCGAAACTCGAGTTTCGCCTTGGTGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-1295s1c1
Sequence:CCGGGAGCCAGTTTATTACCGGAAACTCGAGTTTCCGGTAATAAACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-1479s1c1
Sequence:CCGGCCCACCAAGAGAGGATTTGATCTCGAGATCAAATCCTCTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-2357s1c1
Sequence:CCGGGCACAATGAAAGGATTACCTTCTCGAGAAGGTAATCCTTTCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173451
ARSJ MISSION shRNA shRNA Plasmid DNA
arylsulfatase family, member J
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173451.1-3286s1c1
Sequence:CCGGCGGCAGATAGTGTCTGAACATCTCGAGATGTTCAGACACTATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-2187s1c1
Sequence:CCGGCCCATTTACACCAAGGCGAAACTCGAGTTTCGCCTTGGTGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-1295s1c1
Sequence:CCGGGAGCCAGTTTATTACCGGAAACTCGAGTTTCCGGTAATAAACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-1479s1c1
Sequence:CCGGCCCACCAAGAGAGGATTTGATCTCGAGATCAAATCCTCTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-2357s1c1
Sequence:CCGGGCACAATGAAAGGATTACCTTCTCGAGAAGGTAATCCTTTCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173451
ARSJ MISSION shRNA Lentiviral Transduction Particles
arylsulfatase family, member J
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173451.1-3286s1c1
Sequence:CCGGCGGCAGATAGTGTCTGAACATCTCGAGATGTTCAGACACTATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-2187s1c1
Sequence:CCGGCCCATTTACACCAAGGCGAAACTCGAGTTTCGCCTTGGTGTAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-1295s1c1
Sequence:CCGGGAGCCAGTTTATTACCGGAAACTCGAGTTTCCGGTAATAAACTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-1479s1c1
Sequence:CCGGCCCACCAAGAGAGGATTTGATCTCGAGATCAAATCCTCTCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173451.1-2357s1c1
Sequence:CCGGGCACAATGAAAGGATTACCTTCTCGAGAAGGTAATCCTTTCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024590
VALIDATED
ARSJ MISSION shRNA Bacterial Glycerol Stock
arylsulfatase family, member J
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1736s1c1
Sequence:CCGGCCGATCCATTATCAACATAAACTCGAGTTTATGTTGATAATGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1304s1c1
Sequence:CCGGCGGACTTCAACATTCTATCATCTCGAGATGATAGAATGTTGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024590.2-2329s1c1
Sequence:CCGGGCACAATGAACGGATCACCTTCTCGAGAAGGTGATCCGTTCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1453s1c1
Sequence:CCGGCCACCAGAAGAGGATTTGATACTCGAGTATCAAATCCTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024590.2-2073s1c1
Sequence:CCGGGACATTCAACTAGATGGCTATCTCGAGATAGCCATCTAGTTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024590
VALIDATED
ARSJ MISSION shRNA shRNA Plasmid DNA
arylsulfatase family, member J
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1736s1c1
Sequence:CCGGCCGATCCATTATCAACATAAACTCGAGTTTATGTTGATAATGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1304s1c1
Sequence:CCGGCGGACTTCAACATTCTATCATCTCGAGATGATAGAATGTTGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024590.2-2329s1c1
Sequence:CCGGGCACAATGAACGGATCACCTTCTCGAGAAGGTGATCCGTTCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1453s1c1
Sequence:CCGGCCACCAGAAGAGGATTTGATACTCGAGTATCAAATCCTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024590.2-2073s1c1
Sequence:CCGGGACATTCAACTAGATGGCTATCTCGAGATAGCCATCTAGTTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024590
VALIDATED
ARSJ MISSION shRNA Lentiviral Transduction Particles
arylsulfatase family, member J
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1736s1c1
Sequence:CCGGCCGATCCATTATCAACATAAACTCGAGTTTATGTTGATAATGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1304s1c1
Sequence:CCGGCGGACTTCAACATTCTATCATCTCGAGATGATAGAATGTTGAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024590.2-2329s1c1
Sequence:CCGGGCACAATGAACGGATCACCTTCTCGAGAAGGTGATCCGTTCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024590.2-1453s1c1
Sequence:CCGGCCACCAGAAGAGGATTTGATACTCGAGTATCAAATCCTCTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_024590.2-2073s1c1
Sequence:CCGGGACATTCAACTAGATGGCTATCTCGAGATAGCCATCTAGTTGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks