EMAIL THIS PAGE TO A FRIEND

ARSK

arylsulfatase family, member K

Synonyms: TSULF
UniProtKB ID: Q6UWY0, A2BDE3, B4E1I4, Q3ZCW3, Q8N3Q8
Gene ID:
Human(153642) Summary: Sulfatases (EC 3.1.5.6), such as ARSK, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]
Mouse(77041) arylsulfatase K
Rat(365619) arylsulfatase family, member K
Zebrafish(562412) arylsulfatase family, member K
cow(533618) arylsulfatase family, member K
domestic cat(101087966) arylsulfatase family, member K
dog(488903) arylsulfatase family, member K
chicken(427116) arylsulfatase family, member K
sheep(101109354) arylsulfatase family, member K
Domestic Rabbit(100350747) arylsulfatase family, member K
naked mole-rat(101698699) arylsulfatase family, member K
domestic guinea pig(100717888) arylsulfatase family, member K
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198150 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198150 Rosetta Predictions human pricing
NM_001047917 Rosetta Predictions rat pricing
NM_029847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055703 predicted 1180
2 SASI_Hs01_00055704 predicted 649
3 SASI_Hs01_00055706 predicted 1290
4 SASI_Hs02_00371685 predicted 1586
5 SASI_Hs01_00055707 predicted 244
6 SASI_Hs01_00055708 predicted 1051
7 SASI_Hs01_00055709 predicted 1399
8 SASI_Hs01_00055710 predicted 1419
9 SASI_Hs01_00055711 predicted 1554
10 SASI_Hs02_00371686 predicted 625
11 SASI_Hs01_00055702 predicted 521
12 SASI_Hs01_00055705 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206782 predicted 746
2 SASI_Rn02_00206783 predicted 1033
3 SASI_Rn02_00206784 predicted 539
4 SASI_Rn02_00206785 predicted 645
5 SASI_Rn02_00206786 predicted 479
6 SASI_Rn02_00206787 predicted 977
7 SASI_Rn02_00206788 predicted 275
8 SASI_Rn02_00206789 predicted 358
9 SASI_Rn02_00206790 predicted 1151
10 SASI_Rn02_00206791 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200700 predicted 1689
2 SASI_Mm01_00200701 predicted 1624
3 SASI_Mm01_00200703 predicted 740
4 SASI_Mm01_00200704 predicted 645
5 SASI_Mm02_00336052 predicted 1540
6 SASI_Mm01_00200705 predicted 1106
7 SASI_Mm02_00336053 predicted 1911
8 SASI_Mm01_00200707 predicted 519
9 SASI_Mm01_00200708 predicted 439
10 SASI_Mm01_00200709 predicted 704
11 SASI_Mm01_00200702 predicted 323
12 SASI_Mm01_00200706 predicted 1475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029847
ARSK MISSION shRNA Bacterial Glycerol Stock
arylsulfatase family, member K
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029847.2-1373s1c1
Sequence:CCGGCCAGTGGAAGTACATAGCCTACTCGAGTAGGCTATGTACTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029847.2-969s1c1
Sequence:CCGGGCCATGCTAGGTGAAATTATTCTCGAGAATAATTTCACCTAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-1443s1c1
Sequence:CCGGCCGGATGAGCTAACAAACATTCTCGAGAATGTTTGTTAGCTCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-1505s1c1
Sequence:CCGGGCTTCGTTCTATTGTAAACTACTCGAGTAGTTTACAATAGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029847.2-2444s1c1
Sequence:CCGGGCAGGCATATACACAATTGATCTCGAGATCAATTGTGTATATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-993s1c1
Sequence:CCGGGCTCTTCACAAGTTAGATCTTCTCGAGAAGATCTAACTTGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029847.2-2266s1c1
Sequence:CCGGCGTGAATATAGGTTGATTGTACTCGAGTACAATCAACCTATATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029847
ARSK MISSION shRNA shRNA Plasmid DNA
arylsulfatase family, member K
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029847.2-1373s1c1
Sequence:CCGGCCAGTGGAAGTACATAGCCTACTCGAGTAGGCTATGTACTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029847.2-969s1c1
Sequence:CCGGGCCATGCTAGGTGAAATTATTCTCGAGAATAATTTCACCTAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-1443s1c1
Sequence:CCGGCCGGATGAGCTAACAAACATTCTCGAGAATGTTTGTTAGCTCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-1505s1c1
Sequence:CCGGGCTTCGTTCTATTGTAAACTACTCGAGTAGTTTACAATAGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029847.2-2444s1c1
Sequence:CCGGGCAGGCATATACACAATTGATCTCGAGATCAATTGTGTATATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-993s1c1
Sequence:CCGGGCTCTTCACAAGTTAGATCTTCTCGAGAAGATCTAACTTGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029847.2-2266s1c1
Sequence:CCGGCGTGAATATAGGTTGATTGTACTCGAGTACAATCAACCTATATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029847
ARSK MISSION shRNA Lentiviral Transduction Particles
arylsulfatase family, member K
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029847.2-1373s1c1
Sequence:CCGGCCAGTGGAAGTACATAGCCTACTCGAGTAGGCTATGTACTTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029847.2-969s1c1
Sequence:CCGGGCCATGCTAGGTGAAATTATTCTCGAGAATAATTTCACCTAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-1443s1c1
Sequence:CCGGCCGGATGAGCTAACAAACATTCTCGAGAATGTTTGTTAGCTCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-1505s1c1
Sequence:CCGGGCTTCGTTCTATTGTAAACTACTCGAGTAGTTTACAATAGAACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029847.2-2444s1c1
Sequence:CCGGGCAGGCATATACACAATTGATCTCGAGATCAATTGTGTATATGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029847.2-993s1c1
Sequence:CCGGGCTCTTCACAAGTTAGATCTTCTCGAGAAGATCTAACTTGTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029847.2-2266s1c1
Sequence:CCGGCGTGAATATAGGTTGATTGTACTCGAGTACAATCAACCTATATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198150
VALIDATED
ARSK MISSION shRNA Bacterial Glycerol Stock
arylsulfatase family, member K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1070s1c1
Sequence:CCGGGCCATGGAACATCGACAGTTTCTCGAGAAACTGTCGATGTTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1561s1c1
Sequence:CCGGCCAGTATAATAAAGAGCAGTTCTCGAGAACTGCTCTTTATTATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-482s1c1
Sequence:CCGGCGAACACAGAAATTTGGGAAACTCGAGTTTCCCAAATTTCTGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1511s1c1
Sequence:CCGGCAGAAGCTTCATTCCATTATACTCGAGTATAATGGAATGAAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198150.1-595s1c1
Sequence:CCGGCATGGTTAATCTTATCCGTAACTCGAGTTACGGATAAGATTAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198150.1-2290s1c1
Sequence:CCGGCTGTAACAGTTATGTTCCTTTCTCGAGAAAGGAACATAACTGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198150.1-1980s1c1
Sequence:CCGGGCACACCTATAGTCTCAGCTACTCGAGTAGCTGAGACTATAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-558s21c1
Sequence:CCGGGGACATCACTCCATTAGTAATCTCGAGATTACTAATGGAGTGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-1444s21c1
Sequence:CCGGATTCGGATGGTGCATCAATATCTCGAGATATTGATGCACCATCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-282s21c1
Sequence:CCGGTTCGATGGAAGGTTAACATTTCTCGAGAAATGTTAACCTTCCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198150
VALIDATED
ARSK MISSION shRNA shRNA Plasmid DNA
arylsulfatase family, member K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1070s1c1
Sequence:CCGGGCCATGGAACATCGACAGTTTCTCGAGAAACTGTCGATGTTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1561s1c1
Sequence:CCGGCCAGTATAATAAAGAGCAGTTCTCGAGAACTGCTCTTTATTATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-482s1c1
Sequence:CCGGCGAACACAGAAATTTGGGAAACTCGAGTTTCCCAAATTTCTGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1511s1c1
Sequence:CCGGCAGAAGCTTCATTCCATTATACTCGAGTATAATGGAATGAAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198150.1-595s1c1
Sequence:CCGGCATGGTTAATCTTATCCGTAACTCGAGTTACGGATAAGATTAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198150.1-2290s1c1
Sequence:CCGGCTGTAACAGTTATGTTCCTTTCTCGAGAAAGGAACATAACTGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198150.1-1980s1c1
Sequence:CCGGGCACACCTATAGTCTCAGCTACTCGAGTAGCTGAGACTATAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-558s21c1
Sequence:CCGGGGACATCACTCCATTAGTAATCTCGAGATTACTAATGGAGTGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-1444s21c1
Sequence:CCGGATTCGGATGGTGCATCAATATCTCGAGATATTGATGCACCATCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-282s21c1
Sequence:CCGGTTCGATGGAAGGTTAACATTTCTCGAGAAATGTTAACCTTCCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198150
VALIDATED
ARSK MISSION shRNA Lentiviral Transduction Particles
arylsulfatase family, member K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1070s1c1
Sequence:CCGGGCCATGGAACATCGACAGTTTCTCGAGAAACTGTCGATGTTCCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1561s1c1
Sequence:CCGGCCAGTATAATAAAGAGCAGTTCTCGAGAACTGCTCTTTATTATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-482s1c1
Sequence:CCGGCGAACACAGAAATTTGGGAAACTCGAGTTTCCCAAATTTCTGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198150.1-1511s1c1
Sequence:CCGGCAGAAGCTTCATTCCATTATACTCGAGTATAATGGAATGAAGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198150.1-595s1c1
Sequence:CCGGCATGGTTAATCTTATCCGTAACTCGAGTTACGGATAAGATTAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_198150.1-2290s1c1
Sequence:CCGGCTGTAACAGTTATGTTCCTTTCTCGAGAAAGGAACATAACTGTTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198150.1-1980s1c1
Sequence:CCGGGCACACCTATAGTCTCAGCTACTCGAGTAGCTGAGACTATAGGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-558s21c1
Sequence:CCGGGGACATCACTCCATTAGTAATCTCGAGATTACTAATGGAGTGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-1444s21c1
Sequence:CCGGATTCGGATGGTGCATCAATATCTCGAGATATTGATGCACCATCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_198150.2-282s21c1
Sequence:CCGGTTCGATGGAAGGTTAACATTTCTCGAGAAATGTTAACCTTCCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks