EMAIL THIS PAGE TO A FRIEND

ART1

ADP-ribosyltransferase 1

45 Gene Product Result for
Synonyms: ART2 ARTC1 CD296 RT6
UniProtKB ID: P52961, Q6NTD2, Q96KT9
Gene ID:
Human(417) Summary: ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008]
Mouse(11870) ADP-ribosyltransferase 1
Rat(308873) ADP-ribosyltransferase 1
fruit fly(41295) Arginine methyltransferase 1
cow(539042) ADP-ribosyltransferase 1
cow(407145) ADP-ribosyltransferase 1
domestic cat(101086418) ADP-ribosyltransferase 1
dog(476821) ADP-ribosyltransferase 1
chicken(429485) ADP-ribosyltransferase 1
chicken(768334) ADP-ribosyltransferase 1
domestic guinea pig(100715659) ADP-ribosyltransferase 1
naked mole-rat(101723321) ADP-ribosyltransferase 1
sheep(101102088) ADP-ribosyltransferase 1
Domestic Rabbit(100009387) ADP-ribosyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004314 Rosetta Predictions human pricing
NM_001107541 Rosetta Predictions rat pricing
NM_009710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106122 predicted 919
2 SASI_Hs01_00106123 predicted 347
3 SASI_Hs02_00337342 predicted 536
4 SASI_Hs01_00106124 predicted 952
5 SASI_Hs01_00106126 predicted 918
6 SASI_Hs01_00106127 predicted 781
7 SASI_Hs01_00106128 predicted 926
8 SASI_Hs01_00106129 predicted 921
9 SASI_Hs01_00106130 predicted 547
10 SASI_Hs01_00106131 predicted 1075
11 SASI_Hs01_00106125 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229845 predicted 1125
2 SASI_Rn02_00229846 predicted 671
3 SASI_Rn02_00229847 predicted 1051
4 SASI_Rn02_00229848 predicted 475
5 SASI_Rn02_00229849 predicted 1004
6 SASI_Rn02_00229850 predicted 637
7 SASI_Rn02_00229851 predicted 220
8 SASI_Rn02_00229852 predicted 990
9 SASI_Rn02_00229853 predicted 1118
10 SASI_Rn02_00229854 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035715 predicted 719
2 SASI_Mm01_00035716 predicted 897
3 SASI_Mm01_00035717 predicted 791
4 SASI_Mm01_00035718 predicted 1082
5 SASI_Mm01_00035719 predicted 1142
6 SASI_Mm01_00035720 predicted 1159
7 SASI_Mm02_00316857 predicted 1033
8 SASI_Mm01_00035721 predicted 491
9 SASI_Mm01_00035722 predicted 1113
10 SASI_Mm01_00035724 predicted 692
11 SASI_Mm01_00035723 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004314
ART1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-1005s21c1
Sequence:CCGGCTCTCTGCAGTCTGGTCTTTGCTCGAGCAAAGACCAGACTGCAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004314.2-1151s21c1
Sequence:CCGGCTTTCAGTGTAACCAAGATTCCTCGAGGAATCTTGGTTACACTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-841s21c1
Sequence:CCGGAGACCTTCCAAGTGATCAATGCTCGAGCATTGATCACTTGGAAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-288s21c1
Sequence:CCGGGATCTCAACCACACGGAGTTCCTCGAGGAACTCCGTGTGGTTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-971s1c1
Sequence:CCGGCCATCTGGATAATTCAGCCATCTCGAGATGGCTGAATTATCCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-938s1c1
Sequence:CCGGCATCAAAGACAAGAAGTGCAACTCGAGTTGCACTTCTTGTCTTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-548s1c1
Sequence:CCGGCTCCTTCAAGACACTCCATTTCTCGAGAAATGGAGTGTCTTGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-920s1c1
Sequence:CCGGCACCTACAACTGCGAGTACATCTCGAGATGTACTCGCAGTTGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004314
ART1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-1005s21c1
Sequence:CCGGCTCTCTGCAGTCTGGTCTTTGCTCGAGCAAAGACCAGACTGCAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004314.2-1151s21c1
Sequence:CCGGCTTTCAGTGTAACCAAGATTCCTCGAGGAATCTTGGTTACACTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-841s21c1
Sequence:CCGGAGACCTTCCAAGTGATCAATGCTCGAGCATTGATCACTTGGAAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-288s21c1
Sequence:CCGGGATCTCAACCACACGGAGTTCCTCGAGGAACTCCGTGTGGTTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-971s1c1
Sequence:CCGGCCATCTGGATAATTCAGCCATCTCGAGATGGCTGAATTATCCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-938s1c1
Sequence:CCGGCATCAAAGACAAGAAGTGCAACTCGAGTTGCACTTCTTGTCTTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-548s1c1
Sequence:CCGGCTCCTTCAAGACACTCCATTTCTCGAGAAATGGAGTGTCTTGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-920s1c1
Sequence:CCGGCACCTACAACTGCGAGTACATCTCGAGATGTACTCGCAGTTGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004314
ART1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-1005s21c1
Sequence:CCGGCTCTCTGCAGTCTGGTCTTTGCTCGAGCAAAGACCAGACTGCAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004314.2-1151s21c1
Sequence:CCGGCTTTCAGTGTAACCAAGATTCCTCGAGGAATCTTGGTTACACTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-841s21c1
Sequence:CCGGAGACCTTCCAAGTGATCAATGCTCGAGCATTGATCACTTGGAAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004314.2-288s21c1
Sequence:CCGGGATCTCAACCACACGGAGTTCCTCGAGGAACTCCGTGTGGTTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-971s1c1
Sequence:CCGGCCATCTGGATAATTCAGCCATCTCGAGATGGCTGAATTATCCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-938s1c1
Sequence:CCGGCATCAAAGACAAGAAGTGCAACTCGAGTTGCACTTCTTGTCTTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-548s1c1
Sequence:CCGGCTCCTTCAAGACACTCCATTTCTCGAGAAATGGAGTGTCTTGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004314.1-920s1c1
Sequence:CCGGCACCTACAACTGCGAGTACATCTCGAGATGTACTCGCAGTTGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009710
ART1 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009710.2-2157s1c1
Sequence:CCGGGCAGAGTTTGAAGGCTTAGAACTCGAGTTCTAAGCCTTCAAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-892s1c1
Sequence:CCGGCGCAGTACATACAACTGTGAACTCGAGTTCACAGTTGTATGTACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-304s1c1
Sequence:CCGGGCCAACAAAGTATACGCGGATCTCGAGATCCGCGTATACTTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-223s1c1
Sequence:CCGGGCGTCCTTTGATGACCAGTATCTCGAGATACTGGTCATCAAAGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-816s1c1
Sequence:CCGGCGAAACTTTCCAGGTGATCAACTCGAGTTGATCACCTGGAAAGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009710
ART1 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009710.2-2157s1c1
Sequence:CCGGGCAGAGTTTGAAGGCTTAGAACTCGAGTTCTAAGCCTTCAAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-892s1c1
Sequence:CCGGCGCAGTACATACAACTGTGAACTCGAGTTCACAGTTGTATGTACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-304s1c1
Sequence:CCGGGCCAACAAAGTATACGCGGATCTCGAGATCCGCGTATACTTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-223s1c1
Sequence:CCGGGCGTCCTTTGATGACCAGTATCTCGAGATACTGGTCATCAAAGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-816s1c1
Sequence:CCGGCGAAACTTTCCAGGTGATCAACTCGAGTTGATCACCTGGAAAGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009710
ART1 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009710.2-2157s1c1
Sequence:CCGGGCAGAGTTTGAAGGCTTAGAACTCGAGTTCTAAGCCTTCAAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-892s1c1
Sequence:CCGGCGCAGTACATACAACTGTGAACTCGAGTTCACAGTTGTATGTACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-304s1c1
Sequence:CCGGGCCAACAAAGTATACGCGGATCTCGAGATCCGCGTATACTTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-223s1c1
Sequence:CCGGGCGTCCTTTGATGACCAGTATCTCGAGATACTGGTCATCAAAGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009710.2-816s1c1
Sequence:CCGGCGAAACTTTCCAGGTGATCAACTCGAGTTGATCACCTGGAAAGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)