EMAIL THIS PAGE TO A FRIEND

ART3

ADP-ribosyltransferase 3

Synonyms: ARTC3
UniProtKB ID: Q13508, Q53XW3, Q6FHT7, Q8WVJ7, Q93069, Q96HL1
Gene ID:
Human(419) Summary: This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(109979) ADP-ribosyltransferase 3
Rat(305235) ADP-ribosyltransferase 3
fruit fly(41837) Arginine methyltransferase 3
domestic cat(101099636) ADP-ribosyltransferase 3
cow(407147) ADP-ribosyltransferase 3
dog(478434) ADP-ribosyltransferase 3
domestic guinea pig(100715456) ADP-ribosyltransferase 3
naked mole-rat(101718202) ADP-ribosyltransferase 3
sheep(101108229) ADP-ribosyltransferase 3
Domestic Rabbit(100009365) ADP-ribosyltransferase 3
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001179 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001179 Rosetta Predictions human pricing
NM_001012034 Rosetta Predictions rat pricing
XM_573565 Rosetta Predictions rat pricing
NM_181728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184870 predicted 870
2 SASI_Hs01_00184871 predicted 339
3 SASI_Hs02_00331307 predicted 1239
4 SASI_Hs01_00184872 predicted 515
5 SASI_Hs01_00184874 predicted 880
6 SASI_Hs01_00184875 predicted 395
7 SASI_Hs01_00184877 predicted 565
8 SASI_Hs01_00184878 predicted 1108
9 SASI_Hs01_00184879 predicted 1189
10 SASI_Hs02_00331308 predicted 675
11 SASI_Hs01_00184873 predicted 1104
12 SASI_Hs01_00184876 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083207 predicted 545
2 SASI_Rn01_00083208 predicted 206
3 SASI_Rn01_00083209 predicted 840
4 SASI_Rn01_00083210 predicted 638
5 SASI_Rn01_00083211 predicted 374
6 SASI_Rn02_00200131 predicted 689
7 SASI_Rn01_00083213 predicted 480
8 SASI_Rn01_00083214 predicted 193
9 SASI_Rn01_00083215 predicted 671
10 SASI_Rn01_00083216 predicted 1064
11 SASI_Rn01_00083212 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192464 predicted 1698
2 SASI_Rn01_00192465 predicted 1053
3 SASI_Rn01_00192466 predicted 1732
4 SASI_Rn01_00192467 predicted 1251
5 SASI_Rn01_00192468 predicted 1354
6 SASI_Rn01_00192469 predicted 1136
7 SASI_Rn01_00192470 predicted 1619
8 SASI_Rn01_00192471 predicted 992
9 SASI_Rn01_00192472 predicted 978
10 SASI_Rn01_00192473 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349888 predicted 308
2 SASI_Mm02_00349889 predicted 357
3 SASI_Mm02_00349890 predicted 256
4 SASI_Mm02_00349891 predicted 1056
5 SASI_Mm01_00156235 predicted 771
6 SASI_Mm01_00156236 predicted 713
7 SASI_Mm01_00156237 predicted 548
8 SASI_Mm01_00156238 predicted 1276
9 SASI_Mm02_00349892 predicted 325
10 SASI_Mm02_00349893 predicted 315
11 SASI_Mm01_00156231 predicted 858
12 SASI_Mm01_00156232 predicted 328
13 SASI_Mm01_00156233 predicted 846
14 SASI_Mm01_00156234 predicted 842
15 SASI_Mm01_00156239 predicted 875
16 SASI_Mm01_00156240 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181728
ART3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181728.1-1197s1c1
Sequence:CCGGCCTTGGACAGACTTGACTGTACTCGAGTACAGTCAAGTCTGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-627s1c1
Sequence:CCGGCGTGGGAAAGTTTCTTAATAACTCGAGTTATTAAGAAACTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-134s1c1
Sequence:CCGGGCAGAATGGAATCGAAGTATACTCGAGTATACTTCGATTCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-494s1c1
Sequence:CCGGGCCCAGACATTTCATTCACATCTCGAGATGTGAATGAAATGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-921s1c1
Sequence:CCGGCCTGACAGAATGCCAGAAATTCTCGAGAATTTCTGGCATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181728
ART3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181728.1-1197s1c1
Sequence:CCGGCCTTGGACAGACTTGACTGTACTCGAGTACAGTCAAGTCTGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-627s1c1
Sequence:CCGGCGTGGGAAAGTTTCTTAATAACTCGAGTTATTAAGAAACTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-134s1c1
Sequence:CCGGGCAGAATGGAATCGAAGTATACTCGAGTATACTTCGATTCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-494s1c1
Sequence:CCGGGCCCAGACATTTCATTCACATCTCGAGATGTGAATGAAATGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-921s1c1
Sequence:CCGGCCTGACAGAATGCCAGAAATTCTCGAGAATTTCTGGCATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181728
ART3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181728.1-1197s1c1
Sequence:CCGGCCTTGGACAGACTTGACTGTACTCGAGTACAGTCAAGTCTGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-627s1c1
Sequence:CCGGCGTGGGAAAGTTTCTTAATAACTCGAGTTATTAAGAAACTTTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-134s1c1
Sequence:CCGGGCAGAATGGAATCGAAGTATACTCGAGTATACTTCGATTCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-494s1c1
Sequence:CCGGGCCCAGACATTTCATTCACATCTCGAGATGTGAATGAAATGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181728.1-921s1c1
Sequence:CCGGCCTGACAGAATGCCAGAAATTCTCGAGAATTTCTGGCATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001179
ART3 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-165s1c1
Sequence:CCGGCCATGATTCTAGTGGACATTTCTCGAGAAATGTCCACTAGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-833s1c1
Sequence:CCGGGCTGGCAATAACCTTATCCTTCTCGAGAAGGATAAGGTTATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-616s1c1
Sequence:CCGGCCAGGGCACTTCATTTACATTCTCGAGAATGTAAATGAAGTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-356s1c1
Sequence:CCGGGCCCGAAAGACTCAAATCTTTCTCGAGAAAGATTTGAGTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-241s1c1
Sequence:CCGGCCTGAAATGTACGGACAGGATCTCGAGATCCTGTCCGTACATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-919s21c1
Sequence:CCGGGTATTGAGAACCTAGAATATTCTCGAGAATATTCTAGGTTCTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-403s21c1
Sequence:CCGGGAATAGCCCTGATGGCATATACTCGAGTATATGCCATCAGGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-1218s21c1
Sequence:CCGGATCAGTGTTTCTGCTATAAATCTCGAGATTTATAGCAGAAACACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001179
ART3 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-165s1c1
Sequence:CCGGCCATGATTCTAGTGGACATTTCTCGAGAAATGTCCACTAGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-833s1c1
Sequence:CCGGGCTGGCAATAACCTTATCCTTCTCGAGAAGGATAAGGTTATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-616s1c1
Sequence:CCGGCCAGGGCACTTCATTTACATTCTCGAGAATGTAAATGAAGTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-356s1c1
Sequence:CCGGGCCCGAAAGACTCAAATCTTTCTCGAGAAAGATTTGAGTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-241s1c1
Sequence:CCGGCCTGAAATGTACGGACAGGATCTCGAGATCCTGTCCGTACATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-919s21c1
Sequence:CCGGGTATTGAGAACCTAGAATATTCTCGAGAATATTCTAGGTTCTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-403s21c1
Sequence:CCGGGAATAGCCCTGATGGCATATACTCGAGTATATGCCATCAGGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-1218s21c1
Sequence:CCGGATCAGTGTTTCTGCTATAAATCTCGAGATTTATAGCAGAAACACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001179
ART3 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-165s1c1
Sequence:CCGGCCATGATTCTAGTGGACATTTCTCGAGAAATGTCCACTAGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-833s1c1
Sequence:CCGGGCTGGCAATAACCTTATCCTTCTCGAGAAGGATAAGGTTATTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-616s1c1
Sequence:CCGGCCAGGGCACTTCATTTACATTCTCGAGAATGTAAATGAAGTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-356s1c1
Sequence:CCGGGCCCGAAAGACTCAAATCTTTCTCGAGAAAGATTTGAGTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001179.2-241s1c1
Sequence:CCGGCCTGAAATGTACGGACAGGATCTCGAGATCCTGTCCGTACATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-919s21c1
Sequence:CCGGGTATTGAGAACCTAGAATATTCTCGAGAATATTCTAGGTTCTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-403s21c1
Sequence:CCGGGAATAGCCCTGATGGCATATACTCGAGTATATGCCATCAGGGCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001179.4-1218s21c1
Sequence:CCGGATCAGTGTTTCTGCTATAAATCTCGAGATTTATAGCAGAAACACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks