EMAIL THIS PAGE TO A FRIEND

ART4

ADP-ribosyltransferase 4 (Dombrock blood group)

66 Gene Product Result for
Synonyms: ARTC4 CD297 DO DOK1
UniProtKB ID: Q93070, Q9BZ50, Q9BZ51, Q9HB06
Gene ID:
Human(420) Summary: This gene encodes a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. Antigens of the Dombrock blood group system are located on the gene product, which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane. Allelic variants, some of which lead to adverse transfusion reactions, are known. [provided by RefSeq, Jul 2008]
Mouse(109978) ADP-ribosyltransferase 4
Rat(312806) ADP-ribosyltransferase 4 (Dombrock blood group)
sheep(101117410) ADP-ribosyltransferase 4 (Dombrock blood group)
sheep(443196) ADP-ribosyltransferase 4 (Dombrock blood group)
Domestic Rabbit(100008862) ADP-ribosyltransferase 4 (Dombrock blood group)
naked mole-rat(101718884) ADP-ribosyltransferase 4 (Dombrock blood group)
domestic guinea pig(100713840) ADP-ribosyltransferase 4 (Dombrock blood group)
Zebrafish(555597) ADP-ribosyltransferase 4 (Dombrock blood group)
fruit fly(41219) Arginine methyltransferase 4
cow(407146) ADP-ribosyltransferase 4 (Dombrock blood group)
domestic cat(101096491) ADP-ribosyltransferase 4 (Dombrock blood group)
dog(486668) ADP-ribosyltransferase 4 (Dombrock blood group)
chicken(427879) ADP-ribosyltransferase 4 (Dombrock blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026639 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026639 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026639 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021071 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009741 MISSION® esiRNA esiRNA targeting human ART4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021071 Rosetta Predictions human pricing
XM_001072607 Rosetta Predictions rat pricing
XM_232495 Rosetta Predictions rat pricing
NM_026639 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354544 predicted 930
2 SASI_Hs02_00354545 predicted 960
3 SASI_Hs01_00071136 predicted 816
4 SASI_Hs01_00071137 predicted 812
5 SASI_Hs02_00354546 predicted 929
6 SASI_Hs02_00354547 predicted 821
7 SASI_Hs02_00354548 predicted 1016
8 SASI_Hs01_00071139 predicted 874
9 SASI_Hs02_00354549 predicted 961
10 SASI_Hs02_00354550 predicted 963
11 SASI_Hs01_00071133 predicted 557
12 SASI_Hs01_00071134 predicted 576
13 SASI_Hs01_00071135 predicted 576
14 SASI_Hs01_00071138 predicted 372
15 SASI_Hs01_00071140 predicted 745
16 SASI_Hs01_00071141 predicted 758
17 SASI_Hs01_00071142 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339848 predicted 617
2 SASI_Rn02_00339849 predicted 539
3 SASI_Rn02_00339850 predicted 1035
4 SASI_Rn02_00339851 predicted 731
5 SASI_Rn02_00339852 predicted 893
6 SASI_Rn02_00339853 predicted 893
7 SASI_Rn02_00339854 predicted 612
8 SASI_Rn02_00339855 predicted 490
9 SASI_Rn02_00339856 predicted 1046
10 SASI_Rn02_00339857 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387140 predicted 288
2 SASI_Rn02_00387141 predicted 284
3 SASI_Rn02_00387142 predicted 287
4 SASI_Rn02_00387143 predicted 287
5 SASI_Rn02_00387144 predicted 292
6 SASI_Rn02_00387145 predicted 631
7 SASI_Rn02_00387146 predicted 532
8 SASI_Rn02_00387147 predicted 556
9 SASI_Rn02_00387148 predicted 223
10 SASI_Rn02_00387149 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078425 predicted 879
2 SASI_Mm01_00078426 predicted 1118
3 SASI_Mm01_00078427 predicted 798
4 SASI_Mm01_00078428 predicted 458
5 SASI_Mm01_00078429 predicted 1044
6 SASI_Mm02_00330626 predicted 441
7 SASI_Mm02_00330627 predicted 467
8 SASI_Mm01_00078430 predicted 472
9 SASI_Mm01_00078431 predicted 1122
10 SASI_Mm01_00078432 predicted 520
11 SASI_Mm01_00078433 predicted 856
12 SASI_Mm01_00078434 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026639
ART4 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 4 (Dombrock blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-522s1c1
Sequence:CCGGAGCTAAATCAAGGAGACTATTCTCGAGAATAGTCTCCTTGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-1204s1c1
Sequence:CCGGCACTGTTGTTATCTCGTCCAACTCGAGTTGGACGAGATAACAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-886s1c1
Sequence:CCGGCGTAGGTTCCACCATTCGATTCTCGAGAATCGAATGGTGGAACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026639.1-1329s1c1
Sequence:CCGGCCACAGAAGATGTGCAAGAAACTCGAGTTTCTTGCACATCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-1109s1c1
Sequence:CCGGGCTGGGAACATGAGCACGTATCTCGAGATACGTGCTCATGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026639
ART4 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 4 (Dombrock blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-522s1c1
Sequence:CCGGAGCTAAATCAAGGAGACTATTCTCGAGAATAGTCTCCTTGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-1204s1c1
Sequence:CCGGCACTGTTGTTATCTCGTCCAACTCGAGTTGGACGAGATAACAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-886s1c1
Sequence:CCGGCGTAGGTTCCACCATTCGATTCTCGAGAATCGAATGGTGGAACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026639.1-1329s1c1
Sequence:CCGGCCACAGAAGATGTGCAAGAAACTCGAGTTTCTTGCACATCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-1109s1c1
Sequence:CCGGGCTGGGAACATGAGCACGTATCTCGAGATACGTGCTCATGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026639
ART4 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 4 (Dombrock blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-522s1c1
Sequence:CCGGAGCTAAATCAAGGAGACTATTCTCGAGAATAGTCTCCTTGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-1204s1c1
Sequence:CCGGCACTGTTGTTATCTCGTCCAACTCGAGTTGGACGAGATAACAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-886s1c1
Sequence:CCGGCGTAGGTTCCACCATTCGATTCTCGAGAATCGAATGGTGGAACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026639.1-1329s1c1
Sequence:CCGGCCACAGAAGATGTGCAAGAAACTCGAGTTTCTTGCACATCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026639.1-1109s1c1
Sequence:CCGGGCTGGGAACATGAGCACGTATCTCGAGATACGTGCTCATGTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021071
ART4 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosyltransferase 4 (Dombrock blood group)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-840s1c1
Sequence:CCGGCCCTCCCTATGAGCTGTTTAACTCGAGTTAAACAGCTCATAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-698s1c1
Sequence:CCGGCCACCATTCGATTTGGCCAATCTCGAGATTGGCCAAATCGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-488s1c1
Sequence:CCGGGCAATGTTCATTCTGACTTTACTCGAGTAAAGTCAGAATGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-765s1c1
Sequence:CCGGCCAGACACTATTTACCATATTCTCGAGAATATGGTAAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-316s1c1
Sequence:CCGGGTTATGGAGAAACTAACTCAACTCGAGTTGAGTTAGTTTCTCCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021071
ART4 MISSION shRNA shRNA Plasmid DNA
ADP-ribosyltransferase 4 (Dombrock blood group)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-840s1c1
Sequence:CCGGCCCTCCCTATGAGCTGTTTAACTCGAGTTAAACAGCTCATAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-698s1c1
Sequence:CCGGCCACCATTCGATTTGGCCAATCTCGAGATTGGCCAAATCGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-488s1c1
Sequence:CCGGGCAATGTTCATTCTGACTTTACTCGAGTAAAGTCAGAATGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-765s1c1
Sequence:CCGGCCAGACACTATTTACCATATTCTCGAGAATATGGTAAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-316s1c1
Sequence:CCGGGTTATGGAGAAACTAACTCAACTCGAGTTGAGTTAGTTTCTCCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021071
ART4 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosyltransferase 4 (Dombrock blood group)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-840s1c1
Sequence:CCGGCCCTCCCTATGAGCTGTTTAACTCGAGTTAAACAGCTCATAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-698s1c1
Sequence:CCGGCCACCATTCGATTTGGCCAATCTCGAGATTGGCCAAATCGAATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-488s1c1
Sequence:CCGGGCAATGTTCATTCTGACTTTACTCGAGTAAAGTCAGAATGAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-765s1c1
Sequence:CCGGCCAGACACTATTTACCATATTCTCGAGAATATGGTAAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021071.1-316s1c1
Sequence:CCGGGTTATGGAGAAACTAACTCAACTCGAGTTGAGTTAGTTTCTCCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks