EMAIL THIS PAGE TO A FRIEND

ARTN

artemin

89 Gene Product Result for
Synonyms: ENOVIN EVN NBN
UniProtKB ID: Q5T4W7, D3DPY1, D3DPY3, O95441, O96030, Q6P6A3
Gene ID:
Human(9048) Summary: The protein encoded by this gene is a member of the glial cell line-derived neurotophic factor (GDNF) family of ligands which are a group of ligands within the TGF-beta superfamily of signaling molecules. GDNFs are unique in having neurotrophic properties and have potential use for gene therapy in neurodegenerative disease. Artemin has been shown in culture to support the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. Its role in the PNS and CNS is further substantiated by its expression pattern in the proximity of these neurons. This protein is a ligand for the RET receptor and uses GFR-alpha 3 as a coreceptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(11876) artemin
Rat(362572) artemin
cow(530812) artemin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501376 Anti-ARTN antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, human, rat, pig
ELISA, western blot pricing
SAB2107821 Anti-ARTN antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP4515 Artemin human recombinant, expressed in E. coli, ≥98% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092211 MISSION® esiRNA esiRNA human ARTN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003976 Rosetta Predictions human pricing
NM_057090 Rosetta Predictions human pricing
NM_057091 Rosetta Predictions human pricing
NM_057160 Rosetta Predictions human pricing
NM_053397 Rosetta Predictions rat pricing
NM_009711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032329 predicted 1151
2 SASI_Hs01_00032330 predicted 864
3 SASI_Hs02_00336669 predicted 1112
4 SASI_Hs01_00032331 predicted 1078
5 SASI_Hs01_00032332 predicted 875
6 SASI_Hs01_00032333 predicted 1153
7 SASI_Hs01_00032334 predicted 983
8 SASI_Hs01_00032335 predicted 1107
9 SASI_Hs01_00032337 predicted 1047
10 SASI_Hs01_00032338 predicted 1018
11 SASI_Hs01_00032336 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156258 predicted 905
2 SASI_Hs01_00156259 predicted 622
3 SASI_Hs02_00361999 predicted 862
4 SASI_Hs01_00156260 predicted 833
5 SASI_Hs01_00156261 predicted 629
6 SASI_Hs01_00156262 predicted 910
7 SASI_Hs01_00156263 predicted 737
8 SASI_Hs01_00156264 predicted 867
9 SASI_Hs01_00156266 predicted 804
10 SASI_Hs01_00156267 predicted 770
11 SASI_Hs01_00156265 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194373 predicted 1635
2 SASI_Hs01_00194374 predicted 1348
3 SASI_Hs02_00362000 predicted 1598
4 SASI_Hs01_00194375 predicted 1565
5 SASI_Hs01_00194376 predicted 1360
6 SASI_Hs01_00194377 predicted 1635
7 SASI_Hs01_00194378 predicted 1469
8 SASI_Hs01_00194379 predicted 1591
9 SASI_Hs01_00194381 predicted 1534
10 SASI_Hs01_00194382 predicted 1507
11 SASI_Hs01_00194380 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152443 predicted 910
2 SASI_Hs01_00152444 predicted 622
3 SASI_Hs02_00362016 predicted 868
4 SASI_Hs01_00152445 predicted 833
5 SASI_Hs01_00152446 predicted 632
6 SASI_Hs01_00152447 predicted 910
7 SASI_Hs01_00152448 predicted 743
8 SASI_Hs01_00152449 predicted 858
9 SASI_Hs01_00152451 predicted 808
10 SASI_Hs01_00152452 predicted 777
11 SASI_Hs01_00152450 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063714 predicted 463
2 SASI_Rn01_00063715 predicted 835
3 SASI_Rn01_00063716 predicted 1097
4 SASI_Rn01_00063717 predicted 1073
5 SASI_Rn02_00265897 predicted 459
6 SASI_Rn01_00063718 predicted 694
7 SASI_Rn01_00063719 predicted 1014
8 SASI_Rn01_00063720 predicted 954
9 SASI_Rn01_00063722 predicted 1002
10 SASI_Rn02_00265898 predicted 1088
11 SASI_Rn01_00063713 predicted 1113
12 SASI_Rn01_00063721 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196885 predicted 1893
2 SASI_Mm01_00196886 predicted 1900
3 SASI_Mm01_00196887 predicted 1906
4 SASI_Mm01_00196888 predicted 1824
5 SASI_Mm01_00196889 predicted 1936
6 SASI_Mm01_00196890 predicted 1936
7 SASI_Mm02_00316858 predicted 1276
8 SASI_Mm01_00196891 predicted 1648
9 SASI_Mm01_00196892 predicted 1278
10 SASI_Mm01_00196893 predicted 1506
11 SASI_Mm01_00196894 predicted 1752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136215
ARTN MISSION shRNA Bacterial Glycerol Stock
artemin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1540s21c1
Sequence:CCGGACACCAGAGACCTCAGCTATGCTCGAGCATAGCTGAGGTCTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136215.1-1242s21c1
Sequence:CCGGGGTCTCCTTCATGGACGTCAACTCGAGTTGACGTCCATGAAGGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1449s21c1
Sequence:CCGGCCGGTGGGTGATGGATATCATCTCGAGATGATATCCATCACCCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1335s21c1
Sequence:CCGGGCTTTGCAGACTGGACCCTTACTCGAGTAAGGGTCCAGTCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1473s21c1
Sequence:CCGGCGAACAGGTGAAGGGACAACTCTCGAGAGTTGTCCCTTCACCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136215
ARTN MISSION shRNA shRNA Plasmid DNA
artemin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1540s21c1
Sequence:CCGGACACCAGAGACCTCAGCTATGCTCGAGCATAGCTGAGGTCTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136215.1-1242s21c1
Sequence:CCGGGGTCTCCTTCATGGACGTCAACTCGAGTTGACGTCCATGAAGGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1449s21c1
Sequence:CCGGCCGGTGGGTGATGGATATCATCTCGAGATGATATCCATCACCCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1335s21c1
Sequence:CCGGGCTTTGCAGACTGGACCCTTACTCGAGTAAGGGTCCAGTCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1473s21c1
Sequence:CCGGCGAACAGGTGAAGGGACAACTCTCGAGAGTTGTCCCTTCACCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136215
ARTN MISSION shRNA Lentiviral Transduction Particles
artemin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1540s21c1
Sequence:CCGGACACCAGAGACCTCAGCTATGCTCGAGCATAGCTGAGGTCTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136215.1-1242s21c1
Sequence:CCGGGGTCTCCTTCATGGACGTCAACTCGAGTTGACGTCCATGAAGGAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1449s21c1
Sequence:CCGGCCGGTGGGTGATGGATATCATCTCGAGATGATATCCATCACCCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1335s21c1
Sequence:CCGGGCTTTGCAGACTGGACCCTTACTCGAGTAAGGGTCCAGTCTGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136215.1-1473s21c1
Sequence:CCGGCGAACAGGTGAAGGGACAACTCTCGAGAGTTGTCCCTTCACCTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009711
ARTN MISSION shRNA Bacterial Glycerol Stock
artemin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009711.2-2005s1c1
Sequence:CCGGCCTCTGGGAGAATCCAGAAATCTCGAGATTTCTGGATTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1510s1c1
Sequence:CCGGCGAGCTGATACGTTTCCGCTTCTCGAGAAGCGGAAACGTATCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1671s1c1
Sequence:CCGGTCTCCTTCATGGACGTGAACACTCGAGTGTTCACGTCCATGAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1139s1c1
Sequence:CCGGTGGTGGCCAACCCTAGCTGTTCTCGAGAACAGCTAGGGTTGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1284s1c1
Sequence:CCGGCGCATTTGTGCAGCGAAAGAACTCGAGTTCTTTCGCTGCACAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009711
ARTN MISSION shRNA shRNA Plasmid DNA
artemin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009711.2-2005s1c1
Sequence:CCGGCCTCTGGGAGAATCCAGAAATCTCGAGATTTCTGGATTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1510s1c1
Sequence:CCGGCGAGCTGATACGTTTCCGCTTCTCGAGAAGCGGAAACGTATCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1671s1c1
Sequence:CCGGTCTCCTTCATGGACGTGAACACTCGAGTGTTCACGTCCATGAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1139s1c1
Sequence:CCGGTGGTGGCCAACCCTAGCTGTTCTCGAGAACAGCTAGGGTTGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1284s1c1
Sequence:CCGGCGCATTTGTGCAGCGAAAGAACTCGAGTTCTTTCGCTGCACAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009711
ARTN MISSION shRNA Lentiviral Transduction Particles
artemin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009711.2-2005s1c1
Sequence:CCGGCCTCTGGGAGAATCCAGAAATCTCGAGATTTCTGGATTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1510s1c1
Sequence:CCGGCGAGCTGATACGTTTCCGCTTCTCGAGAAGCGGAAACGTATCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1671s1c1
Sequence:CCGGTCTCCTTCATGGACGTGAACACTCGAGTGTTCACGTCCATGAAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1139s1c1
Sequence:CCGGTGGTGGCCAACCCTAGCTGTTCTCGAGAACAGCTAGGGTTGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009711.2-1284s1c1
Sequence:CCGGCGCATTTGTGCAGCGAAAGAACTCGAGTTCTTTCGCTGCACAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks