EMAIL THIS PAGE TO A FRIEND

ARV1

ARV1 homolog (S. cerevisiae)

50 Gene Product Result for
Gene ID:
Mouse(68865) ARV1 homolog (yeast)
Rat(292097) ARV1 homolog (S. cerevisiae)
domestic guinea pig(100725222) ARV1 homolog (S. cerevisiae)
naked mole-rat(101713499) ARV1 homolog (S. cerevisiae)
Goat(100861106) ARV1 homolog (S. cerevisiae)
sheep(101110644) ARV1 homolog (S. cerevisiae)
Zebrafish(568203) ARV1 homolog (S. cerevisiae)
cow(515046) ARV1 homolog (S. cerevisiae)
dog(488975) ARV1 homolog (S. cerevisiae)
chicken(421546) ARV1 homolog (S. cerevisiae)
Thale Cress(839569) Arv1-like protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007741 MISSION® esiRNA esiRNA targeting human ARV1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022786 Rosetta Predictions human pricing
NM_001106197 Rosetta Predictions rat pricing
NM_026855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356088 predicted 952
2 SASI_Hs01_00082076 predicted 1087
3 SASI_Hs01_00082077 predicted 244
4 SASI_Hs02_00356089 predicted 922
5 SASI_Hs01_00082078 predicted 1044
6 SASI_Hs01_00082079 predicted 1146
7 SASI_Hs01_00082081 predicted 1114
8 SASI_Hs02_00356090 predicted 207
9 SASI_Hs01_00082082 predicted 978
10 SASI_Hs01_00082083 predicted 272
11 SASI_Hs01_00082074 predicted 1033
12 SASI_Hs01_00082075 predicted 209
13 SASI_Hs01_00082080 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216588 predicted 642
2 SASI_Rn02_00216589 predicted 664
3 SASI_Rn02_00216590 predicted 309
4 SASI_Rn02_00216591 predicted 649
5 SASI_Rn02_00216592 predicted 464
6 SASI_Rn02_00216593 predicted 884
7 SASI_Rn02_00216594 predicted 819
8 SASI_Rn02_00216595 predicted 220
9 SASI_Rn02_00216596 predicted 218
10 SASI_Rn02_00216597 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331063 predicted 802
2 SASI_Mm01_00050585 predicted 209
3 SASI_Mm01_00050587 predicted 752
4 SASI_Mm01_00050588 predicted 760
5 SASI_Mm01_00050589 predicted 426
6 SASI_Mm01_00050590 predicted 812
7 SASI_Mm01_00050591 predicted 817
8 SASI_Mm01_00050592 predicted 599
9 SASI_Mm01_00050593 predicted 470
10 SASI_Mm01_00050594 predicted 439
11 SASI_Mm01_00050586 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022786
VALIDATED
ARV1 MISSION shRNA Bacterial Glycerol Stock
ARV1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-1160s1c1
Sequence:CCGGGCGCTCATAATTCACACATAACTCGAGTTATGTGTGAATTATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022786.1-703s1c1
Sequence:CCGGTGACCCTAAACATCAACCGTACTCGAGTACGGTTGATGTTTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022786.1-704s1c1
Sequence:CCGGGACCCTAAACATCAACCGTAACTCGAGTTACGGTTGATGTTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-211s1c1
Sequence:CCGGGCCAGAAACCTGTAGACAAATCTCGAGATTTGTCTACAGGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-432s1c1
Sequence:CCGGGCTAAGGAATGGGATTTCTATCTCGAGATAGAAATCCCATTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-810s21c1
Sequence:CCGGAGTGATTATGCCATCTTTAAACTCGAGTTTAAAGATGGCATAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022786.1-1124s21c1
Sequence:CCGGGGTGAAGGTTTATACGTTATACTCGAGTATAACGTATAAACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022786.1-1033s21c1
Sequence:CCGGAGCCATTTACATACAGATATTCTCGAGAATATCTGTATGTAAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-233s21c1
Sequence:CCGGTATCGAGTATGATCCTGTTATCTCGAGATAACAGGATCATACTCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-155s21c1
Sequence:CCGGAGAGTTGTACCGAGACTATAACTCGAGTTATAGTCTCGGTACAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022786
VALIDATED
ARV1 MISSION shRNA shRNA Plasmid DNA
ARV1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-1160s1c1
Sequence:CCGGGCGCTCATAATTCACACATAACTCGAGTTATGTGTGAATTATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022786.1-703s1c1
Sequence:CCGGTGACCCTAAACATCAACCGTACTCGAGTACGGTTGATGTTTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022786.1-704s1c1
Sequence:CCGGGACCCTAAACATCAACCGTAACTCGAGTTACGGTTGATGTTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-211s1c1
Sequence:CCGGGCCAGAAACCTGTAGACAAATCTCGAGATTTGTCTACAGGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-432s1c1
Sequence:CCGGGCTAAGGAATGGGATTTCTATCTCGAGATAGAAATCCCATTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-810s21c1
Sequence:CCGGAGTGATTATGCCATCTTTAAACTCGAGTTTAAAGATGGCATAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022786.1-1124s21c1
Sequence:CCGGGGTGAAGGTTTATACGTTATACTCGAGTATAACGTATAAACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022786.1-1033s21c1
Sequence:CCGGAGCCATTTACATACAGATATTCTCGAGAATATCTGTATGTAAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-233s21c1
Sequence:CCGGTATCGAGTATGATCCTGTTATCTCGAGATAACAGGATCATACTCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-155s21c1
Sequence:CCGGAGAGTTGTACCGAGACTATAACTCGAGTTATAGTCTCGGTACAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022786
VALIDATED
ARV1 MISSION shRNA Lentiviral Transduction Particles
ARV1 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-1160s1c1
Sequence:CCGGGCGCTCATAATTCACACATAACTCGAGTTATGTGTGAATTATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022786.1-703s1c1
Sequence:CCGGTGACCCTAAACATCAACCGTACTCGAGTACGGTTGATGTTTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022786.1-704s1c1
Sequence:CCGGGACCCTAAACATCAACCGTAACTCGAGTTACGGTTGATGTTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-211s1c1
Sequence:CCGGGCCAGAAACCTGTAGACAAATCTCGAGATTTGTCTACAGGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022786.1-432s1c1
Sequence:CCGGGCTAAGGAATGGGATTTCTATCTCGAGATAGAAATCCCATTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-810s21c1
Sequence:CCGGAGTGATTATGCCATCTTTAAACTCGAGTTTAAAGATGGCATAATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022786.1-1124s21c1
Sequence:CCGGGGTGAAGGTTTATACGTTATACTCGAGTATAACGTATAAACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022786.1-1033s21c1
Sequence:CCGGAGCCATTTACATACAGATATTCTCGAGAATATCTGTATGTAAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-233s21c1
Sequence:CCGGTATCGAGTATGATCCTGTTATCTCGAGATAACAGGATCATACTCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022786.1-155s21c1
Sequence:CCGGAGAGTTGTACCGAGACTATAACTCGAGTTATAGTCTCGGTACAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026855
VALIDATED
ARV1 MISSION shRNA Bacterial Glycerol Stock
ARV1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026855.1-896s1c1
Sequence:CCGGGCTTTCTGTGAGTGAAGCCAACTCGAGTTGGCTTCACTCACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-235s1c1
Sequence:CCGGCATCGAATACGACCCTGTTATCTCGAGATAACAGGGTCGTATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-222s1c1
Sequence:CCGGCAGTAGACAAATACATCGAATCTCGAGATTCGATGTATTTGTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-488s1c1
Sequence:CCGGGCCTTTCTTACTGGCATATTTCTCGAGAAATATGCCAGTAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-244s1c1
Sequence:CCGGCGACCCTGTTATTATCTTGATCTCGAGATCAAGATAATAACAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026855
VALIDATED
ARV1 MISSION shRNA shRNA Plasmid DNA
ARV1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026855.1-896s1c1
Sequence:CCGGGCTTTCTGTGAGTGAAGCCAACTCGAGTTGGCTTCACTCACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-235s1c1
Sequence:CCGGCATCGAATACGACCCTGTTATCTCGAGATAACAGGGTCGTATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-222s1c1
Sequence:CCGGCAGTAGACAAATACATCGAATCTCGAGATTCGATGTATTTGTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-488s1c1
Sequence:CCGGGCCTTTCTTACTGGCATATTTCTCGAGAAATATGCCAGTAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-244s1c1
Sequence:CCGGCGACCCTGTTATTATCTTGATCTCGAGATCAAGATAATAACAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026855
VALIDATED
ARV1 MISSION shRNA Lentiviral Transduction Particles
ARV1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026855.1-896s1c1
Sequence:CCGGGCTTTCTGTGAGTGAAGCCAACTCGAGTTGGCTTCACTCACAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-235s1c1
Sequence:CCGGCATCGAATACGACCCTGTTATCTCGAGATAACAGGGTCGTATTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-222s1c1
Sequence:CCGGCAGTAGACAAATACATCGAATCTCGAGATTCGATGTATTTGTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-488s1c1
Sequence:CCGGGCCTTTCTTACTGGCATATTTCTCGAGAAATATGCCAGTAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026855.1-244s1c1
Sequence:CCGGCGACCCTGTTATTATCTTGATCTCGAGATCAAGATAATAACAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks