EMAIL THIS PAGE TO A FRIEND

ARVP6125

40 Gene Product Result for
Species: Human ARVP6125(442092)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001030078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001030078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001030078 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030078 Rosetta Predictions human pricing
XR_041956 Rosetta Predictions human pricing
XR_041957 Rosetta Predictions human pricing
XR_041958 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103067 predicted 414
2 SASI_Hs01_00103068 predicted 364
3 SASI_Hs01_00103069 predicted 361
4 SASI_Hs01_00103070 predicted 349
5 SASI_Hs01_00103071 predicted 467
6 SASI_Hs01_00103072 predicted 279
7 SASI_Hs01_00103073 predicted 261
8 SASI_Hs01_00103074 predicted 272
9 SASI_Hs01_00103075 predicted 360
10 SASI_Hs01_00103076 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531792 predicted 252
2 SASI_Hs02_00531793 predicted 24
3 SASI_Hs02_00531794 predicted 54
4 SASI_Hs02_00531795 predicted 250
5 SASI_Hs02_00531796 predicted 245
6 SASI_Hs02_00531797 predicted 177
7 SASI_Hs02_00531798 predicted 155
8 SASI_Hs02_00531799 predicted 165
9 SASI_Hs02_00531800 predicted 251
10 SASI_Hs02_00531801 predicted 104
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531802 predicted 255
2 SASI_Hs02_00531803 predicted 25
3 SASI_Hs02_00531804 predicted 47
4 SASI_Hs02_00531805 predicted 247
5 SASI_Hs02_00531806 predicted 242
6 SASI_Hs02_00531807 predicted 176
7 SASI_Hs02_00531808 predicted 152
8 SASI_Hs02_00531809 predicted 163
9 SASI_Hs02_00531810 predicted 252
10 SASI_Hs02_00531811 predicted 97
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531812 predicted 247
2 SASI_Hs02_00531813 predicted 19
3 SASI_Hs02_00531814 predicted 54
4 SASI_Hs02_00531815 predicted 251
5 SASI_Hs02_00531816 predicted 249
6 SASI_Hs02_00531817 predicted 179
7 SASI_Hs02_00531818 predicted 153
8 SASI_Hs02_00531819 predicted 164
9 SASI_Hs02_00531820 predicted 251
10 SASI_Hs02_00531821 predicted 103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001030078
ARVP6125 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030078.1-698s1c1
Sequence:CCGGGCTAAATACATAGGTCTCCTTCTCGAGAAGGAGACCTATGTATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030078.1-759s1c1
Sequence:CCGGGCTATTACACTGCCTTGCTAACTCGAGTTAGCAAGGCAGTGTAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030078.1-178s1c1
Sequence:CCGGCCAGAAGAAAGCACAAACCATCTCGAGATGGTTTGTGCTTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030078.1-378s1c1
Sequence:CCGGGTTTCTCTTTCAGTACGAGCTCTCGAGAGCTCGTACTGAAAGAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001030078
ARVP6125 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030078.1-698s1c1
Sequence:CCGGGCTAAATACATAGGTCTCCTTCTCGAGAAGGAGACCTATGTATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030078.1-759s1c1
Sequence:CCGGGCTATTACACTGCCTTGCTAACTCGAGTTAGCAAGGCAGTGTAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030078.1-178s1c1
Sequence:CCGGCCAGAAGAAAGCACAAACCATCTCGAGATGGTTTGTGCTTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030078.1-378s1c1
Sequence:CCGGGTTTCTCTTTCAGTACGAGCTCTCGAGAGCTCGTACTGAAAGAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001030078
ARVP6125 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030078.1-698s1c1
Sequence:CCGGGCTAAATACATAGGTCTCCTTCTCGAGAAGGAGACCTATGTATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001030078.1-759s1c1
Sequence:CCGGGCTATTACACTGCCTTGCTAACTCGAGTTAGCAAGGCAGTGTAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030078.1-178s1c1
Sequence:CCGGCCAGAAGAAAGCACAAACCATCTCGAGATGGTTTGTGCTTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001030078.1-378s1c1
Sequence:CCGGGTTTCTCTTTCAGTACGAGCTCTCGAGAGCTCGTACTGAAAGAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)