EMAIL THIS PAGE TO A FRIEND

ARX

aristaless related homeobox

69 Gene Product Result for
Synonyms: CT121 EIEE1 ISSX MRX29 MRX32 MRX33 MRX36 MRX38 MRX43 MRX54 MRX76 MRX87 MRXS1 PRTS
UniProtKB ID: Q96QS3
Gene ID:
Human(170302) Summary: This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Mutations in this gene cause X-linked mental retardation and epilepsy. [provided by RefSeq, Jul 2008]
Mouse(11878) aristaless related homeobox
Rat(317268) aristaless related homeobox
dog(608251) aristaless related homeobox
cow(529211) aristaless related homeobox
domestic guinea pig(100725635) aristaless related homeobox
sheep(101108992) aristaless related homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36824 Anti-ARX (AB1) antibody produced in rabbit IgG fraction of antiserum rabbit, canine, mouse, horse, human, rat, guinea pig
western blot pricing
AV36825 Anti-ARX (AB2) antibody produced in rabbit IgG fraction of antiserum human, rat, canine, mouse
western blot pricing
SAB2100159 Anti-ARX antibody produced in rabbit affinity isolated antibody human, rat, canine, mouse, rabbit
western blot pricing
WH0170302M1 Monoclonal Anti-ARX antibody produced in mouse clone 1G2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408937 Monoclonal Anti-ARX antibody produced in mouse clone 1G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1408938 Monoclonal Anti-ARX antibody produced in mouse clone 4A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408939 Monoclonal Anti-ARX antibody produced in mouse clone 2A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408940 Monoclonal Anti-ARX antibody produced in mouse clone 3A4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408941 Monoclonal Anti-ARX antibody produced in mouse clone 1B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408942 Monoclonal Anti-ARX antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405379 Monoclonal Anti-ARX, (N-terminal) antibody produced in mouse clone 4H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038531 MISSION® esiRNA esiRNA targeting mouse Arx (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139058 Rosetta Predictions human pricing
NM_001100174 Rosetta Predictions rat pricing
NM_007492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090679 predicted 1168
2 SASI_Hs01_00090680 predicted 1258
3 SASI_Hs01_00090681 predicted 1235
4 SASI_Hs01_00090682 predicted 1190
5 SASI_Hs02_00364114 predicted 241
6 SASI_Hs02_00364115 predicted 222
7 SASI_Hs01_00090683 predicted 1262
8 SASI_Hs01_00090684 predicted 1198
9 SASI_Hs01_00090685 predicted 1232
10 SASI_Hs02_00364116 predicted 287
11 SASI_Hs01_00090686 predicted 986
12 SASI_Hs01_00090687 predicted 1048
13 SASI_Hs01_00090688 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209824 predicted 1779
2 SASI_Rn02_00209825 predicted 250
3 SASI_Rn02_00209826 predicted 1986
4 SASI_Rn02_00209827 predicted 227
5 SASI_Rn02_00209828 predicted 1260
6 SASI_Rn02_00209829 predicted 2209
7 SASI_Rn02_00209830 predicted 2252
8 SASI_Rn02_00209831 predicted 2052
9 SASI_Rn02_00209832 predicted 2087
10 SASI_Rn02_00209833 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050951 predicted 1662
2 SASI_Mm01_00050952 predicted 2091
3 SASI_Mm01_00050953 predicted 1908
4 SASI_Mm01_00050954 predicted 1162
5 SASI_Mm02_00311762 predicted 1509
6 SASI_Mm01_00050955 predicted 2093
7 SASI_Mm02_00311763 predicted 1833
8 SASI_Mm01_00050956 predicted 1132
9 SASI_Mm01_00050957 predicted 2015
10 SASI_Mm01_00050959 predicted 2132
11 SASI_Mm01_00050958 predicted 1933
12 SASI_Mm01_00050960 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139058
ARX MISSION shRNA Bacterial Glycerol Stock
aristaless related homeobox
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-1571s1c1
Sequence:CCGGCCGCAGACAGACGCGCCTCTACTCGAGTAGAGGCGCGTCTGTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-513s1c1
Sequence:CCGGCAGCAAGTCGTACCGCGAGAACTCGAGTTCTCGCGGTACGACTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-75s1c1
Sequence:CCGGCTCCTACTGCATCGACAGCATCTCGAGATGCTGTCGATGCAGTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-972s1c1
Sequence:CCGGGAAACGCAAACAGAGGCGCTACTCGAGTAGCGCCTCTGTTTGCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-1402s1c1
Sequence:CCGGGCGGCAGTGTTCCGACACCCACTCGAGTGGGTGTCGGAACACTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139058.2-2132s21c1
Sequence:CCGGACCTCGCTCCAACTCCAACATCTCGAGATGTTGGAGTTGGAGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139058.2-263s21c1
Sequence:CCGGAGTAAATCTCCAACTTTGCTCCTCGAGGAGCAAAGTTGGAGATTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139058
ARX MISSION shRNA shRNA Plasmid DNA
aristaless related homeobox
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-1571s1c1
Sequence:CCGGCCGCAGACAGACGCGCCTCTACTCGAGTAGAGGCGCGTCTGTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-513s1c1
Sequence:CCGGCAGCAAGTCGTACCGCGAGAACTCGAGTTCTCGCGGTACGACTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-75s1c1
Sequence:CCGGCTCCTACTGCATCGACAGCATCTCGAGATGCTGTCGATGCAGTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-972s1c1
Sequence:CCGGGAAACGCAAACAGAGGCGCTACTCGAGTAGCGCCTCTGTTTGCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-1402s1c1
Sequence:CCGGGCGGCAGTGTTCCGACACCCACTCGAGTGGGTGTCGGAACACTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139058.2-2132s21c1
Sequence:CCGGACCTCGCTCCAACTCCAACATCTCGAGATGTTGGAGTTGGAGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139058.2-263s21c1
Sequence:CCGGAGTAAATCTCCAACTTTGCTCCTCGAGGAGCAAAGTTGGAGATTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139058
ARX MISSION shRNA Lentiviral Transduction Particles
aristaless related homeobox
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-1571s1c1
Sequence:CCGGCCGCAGACAGACGCGCCTCTACTCGAGTAGAGGCGCGTCTGTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-513s1c1
Sequence:CCGGCAGCAAGTCGTACCGCGAGAACTCGAGTTCTCGCGGTACGACTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-75s1c1
Sequence:CCGGCTCCTACTGCATCGACAGCATCTCGAGATGCTGTCGATGCAGTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-972s1c1
Sequence:CCGGGAAACGCAAACAGAGGCGCTACTCGAGTAGCGCCTCTGTTTGCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139058.1-1402s1c1
Sequence:CCGGGCGGCAGTGTTCCGACACCCACTCGAGTGGGTGTCGGAACACTGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139058.2-2132s21c1
Sequence:CCGGACCTCGCTCCAACTCCAACATCTCGAGATGTTGGAGTTGGAGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139058.2-263s21c1
Sequence:CCGGAGTAAATCTCCAACTTTGCTCCTCGAGGAGCAAAGTTGGAGATTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007492
ARX MISSION shRNA Bacterial Glycerol Stock
aristaless related homeobox
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-129s1c1
Sequence:CCGGGCAAGAGTAAATCTCCAACTTCTCGAGAAGTTGGAGATTTACTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-583s1c1
Sequence:CCGGCATCAGTCGTAGCAAGTCGTACTCGAGTACGACTTGCTACGACTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-1659s1c1
Sequence:CCGGCGGCAGACAGACGCGCGTCAACTCGAGTTGACGCGCGTCTGTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-1522s1c1
Sequence:CCGGCCCAGCATTTGGCAGGCTCTTCTCGAGAAGAGCCTGCCAAATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007492.3-2091s1c1
Sequence:CCGGCCCAATATGCTTAGTATTGAACTCGAGTTCAATACTAAGCATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007492.3-1930s21c1
Sequence:CCGGAGGCAGTTCTTGGCGCTAAAGCTCGAGCTTTAGCGCCAAGAACTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007492.3-1124s21c1
Sequence:CCGGGCTTTCCAGAAGACGCACTACCTCGAGGTAGTGCGTCTTCTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007492.3-2021s21c1
Sequence:CCGGCAATGTCACTCCAACTCAAAGCTCGAGCTTTGAGTTGGAGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007492
ARX MISSION shRNA shRNA Plasmid DNA
aristaless related homeobox
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-129s1c1
Sequence:CCGGGCAAGAGTAAATCTCCAACTTCTCGAGAAGTTGGAGATTTACTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-583s1c1
Sequence:CCGGCATCAGTCGTAGCAAGTCGTACTCGAGTACGACTTGCTACGACTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-1659s1c1
Sequence:CCGGCGGCAGACAGACGCGCGTCAACTCGAGTTGACGCGCGTCTGTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-1522s1c1
Sequence:CCGGCCCAGCATTTGGCAGGCTCTTCTCGAGAAGAGCCTGCCAAATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007492.3-2091s1c1
Sequence:CCGGCCCAATATGCTTAGTATTGAACTCGAGTTCAATACTAAGCATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007492.3-1930s21c1
Sequence:CCGGAGGCAGTTCTTGGCGCTAAAGCTCGAGCTTTAGCGCCAAGAACTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007492.3-1124s21c1
Sequence:CCGGGCTTTCCAGAAGACGCACTACCTCGAGGTAGTGCGTCTTCTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007492.3-2021s21c1
Sequence:CCGGCAATGTCACTCCAACTCAAAGCTCGAGCTTTGAGTTGGAGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007492
ARX MISSION shRNA Lentiviral Transduction Particles
aristaless related homeobox
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-129s1c1
Sequence:CCGGGCAAGAGTAAATCTCCAACTTCTCGAGAAGTTGGAGATTTACTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-583s1c1
Sequence:CCGGCATCAGTCGTAGCAAGTCGTACTCGAGTACGACTTGCTACGACTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-1659s1c1
Sequence:CCGGCGGCAGACAGACGCGCGTCAACTCGAGTTGACGCGCGTCTGTCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007492.3-1522s1c1
Sequence:CCGGCCCAGCATTTGGCAGGCTCTTCTCGAGAAGAGCCTGCCAAATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007492.3-2091s1c1
Sequence:CCGGCCCAATATGCTTAGTATTGAACTCGAGTTCAATACTAAGCATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007492.3-1930s21c1
Sequence:CCGGAGGCAGTTCTTGGCGCTAAAGCTCGAGCTTTAGCGCCAAGAACTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007492.3-1124s21c1
Sequence:CCGGGCTTTCCAGAAGACGCACTACCTCGAGGTAGTGCGTCTTCTGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007492.3-2021s21c1
Sequence:CCGGCAATGTCACTCCAACTCAAAGCTCGAGCTTTGAGTTGGAGTGACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks