EMAIL THIS PAGE TO A FRIEND

AS3MT

arsenic (+3 oxidation state) methyltransferase

Synonyms: CYT19
UniProtKB ID: Q9HBK9, A6NP79, Q5PZ02
Gene ID:
Human(57412) Summary: AS3MT catalyzes the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to trivalent arsenical and may play a role in arsenic metabolism (Lin et al., 2002 [PubMed 11790780]
Mouse(57344) arsenic (+3 oxidation state) methyltransferase
Rat(140925) arsenic (+3 oxidation state) methyltransferase
Goat(100861071) arsenic (+3 oxidation state) methyltransferase
Domestic Rabbit(100341970) arsenic (+3 oxidation state) methyltransferase
sheep(101115498) arsenic (+3 oxidation state) methyltransferase
Zebrafish(664699) arsenic (+3 oxidation state) methyltransferase
cow(788389) arsenic (+3 oxidation state) methyltransferase-like
cow(505482) arsenic (+3 oxidation state) methyltransferase
Horse(100069819) arsenic (+3 oxidation state) methyltransferase
domestic cat(101085409) arsenic (+3 oxidation state) methyltransferase
dog(486865) arsenic (+3 oxidation state) methyltransferase
chicken(423870) arsenic (+3 oxidation state) methyltransferase
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020682 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067901 MISSION® esiRNA esiRNA targeting mouse As3mt (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020682 Rosetta Predictions human pricing
NM_080890 Rosetta Predictions rat pricing
NM_020577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062235 predicted 288
2 SASI_Hs01_00062236 predicted 377
3 SASI_Hs01_00062237 predicted 581
4 SASI_Hs01_00062238 predicted 307
5 SASI_Hs02_00353674 predicted 1143
6 SASI_Hs02_00353675 predicted 579
7 SASI_Hs01_00062239 predicted 935
8 SASI_Hs01_00062240 predicted 1067
9 SASI_Hs01_00062242 predicted 589
10 SASI_Hs01_00062243 predicted 819
11 SASI_Hs01_00062241 predicted 1102
12 SASI_Hs01_00062244 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096119 predicted 1041
2 SASI_Rn01_00096120 predicted 281
3 SASI_Rn01_00096121 predicted 1055
4 SASI_Rn01_00096123 predicted 574
5 SASI_Rn01_00096124 predicted 1026
6 SASI_Rn01_00096125 predicted 1184
7 SASI_Rn01_00096126 predicted 345
8 SASI_Rn01_00096127 predicted 623
9 SASI_Rn01_00096128 predicted 494
10 SASI_Rn02_00267341 predicted 204
11 SASI_Rn01_00096122 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181734 predicted 565
2 SASI_Mm01_00181735 predicted 676
3 SASI_Mm01_00181738 predicted 786
4 SASI_Mm01_00181740 predicted 549
5 SASI_Mm02_00325643 predicted 532
6 SASI_Mm01_00181739 predicted 630
7 SASI_Mm02_00325644 predicted 228
8 SASI_Mm01_00181742 predicted 381
9 SASI_Mm02_00325645 predicted 1090
10 SASI_Mm01_00181743 predicted 724
11 SASI_Mm01_00181736 predicted 513
12 SASI_Mm01_00181737 predicted 1086
13 SASI_Mm01_00181741 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020577
AS3MT MISSION shRNA Bacterial Glycerol Stock
arsenic (+3 oxidation state) methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020577.1-1328s1c1
Sequence:CCGGGCTAAGAATAAGAGTGACTTTCTCGAGAAAGTCACTCTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-764s1c1
Sequence:CCGGGCCGATATCATTACTGTTGAACTCGAGTTCAACAGTAATGATATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-104s1c1
Sequence:CCGGGTTCAGAACTACTATGGGAATCTCGAGATTCCCATAGTAGTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-765s1c1
Sequence:CCGGCCGATATCATTACTGTTGAAACTCGAGTTTCAACAGTAATGATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-220s1c1
Sequence:CCGGCGAAGACGTTAGTTCGAGGTACTCGAGTACCTCGAACTAACGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020577
AS3MT MISSION shRNA shRNA Plasmid DNA
arsenic (+3 oxidation state) methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020577.1-1328s1c1
Sequence:CCGGGCTAAGAATAAGAGTGACTTTCTCGAGAAAGTCACTCTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-764s1c1
Sequence:CCGGGCCGATATCATTACTGTTGAACTCGAGTTCAACAGTAATGATATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-104s1c1
Sequence:CCGGGTTCAGAACTACTATGGGAATCTCGAGATTCCCATAGTAGTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-765s1c1
Sequence:CCGGCCGATATCATTACTGTTGAAACTCGAGTTTCAACAGTAATGATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-220s1c1
Sequence:CCGGCGAAGACGTTAGTTCGAGGTACTCGAGTACCTCGAACTAACGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020577
AS3MT MISSION shRNA Lentiviral Transduction Particles
arsenic (+3 oxidation state) methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020577.1-1328s1c1
Sequence:CCGGGCTAAGAATAAGAGTGACTTTCTCGAGAAAGTCACTCTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-764s1c1
Sequence:CCGGGCCGATATCATTACTGTTGAACTCGAGTTCAACAGTAATGATATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-104s1c1
Sequence:CCGGGTTCAGAACTACTATGGGAATCTCGAGATTCCCATAGTAGTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-765s1c1
Sequence:CCGGCCGATATCATTACTGTTGAAACTCGAGTTTCAACAGTAATGATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020577.1-220s1c1
Sequence:CCGGCGAAGACGTTAGTTCGAGGTACTCGAGTACCTCGAACTAACGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020682
AS3MT MISSION shRNA Bacterial Glycerol Stock
arsenic (+3 oxidation state) methyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-449s1c1
Sequence:CCGGCCAGGCATCTAATGTGACTTTCTCGAGAAAGTCACATTAGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-643s1c1
Sequence:CCGGGCCTTGAACTGCCAGAAGAAACTCGAGTTTCTTCTGGCAGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-322s1c1
Sequence:CCGGGCAGAGATTGCTATGTACTTACTCGAGTAAGTACATAGCAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-930s1c1
Sequence:CCGGGAACTAATGTTTGATGCCAATCTCGAGATTGGCATCAAACATTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-561s1c1
Sequence:CCGGCCTGATAAACAACAAGTGCTTCTCGAGAAGCACTTGTTGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-612s21c1
Sequence:CCGGATTAACCTTGTGCCTGATAAACTCGAGTTTATCAGGCACAAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-942s21c1
Sequence:CCGGACCAAGAGATGCCAAGTTATTCTCGAGAATAACTTGGCATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-995s21c1
Sequence:CCGGACTAATGTTTGATGCCAATTTCTCGAGAAATTGGCATCAAACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020682
AS3MT MISSION shRNA shRNA Plasmid DNA
arsenic (+3 oxidation state) methyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-449s1c1
Sequence:CCGGCCAGGCATCTAATGTGACTTTCTCGAGAAAGTCACATTAGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-643s1c1
Sequence:CCGGGCCTTGAACTGCCAGAAGAAACTCGAGTTTCTTCTGGCAGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-322s1c1
Sequence:CCGGGCAGAGATTGCTATGTACTTACTCGAGTAAGTACATAGCAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-930s1c1
Sequence:CCGGGAACTAATGTTTGATGCCAATCTCGAGATTGGCATCAAACATTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-561s1c1
Sequence:CCGGCCTGATAAACAACAAGTGCTTCTCGAGAAGCACTTGTTGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-612s21c1
Sequence:CCGGATTAACCTTGTGCCTGATAAACTCGAGTTTATCAGGCACAAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-942s21c1
Sequence:CCGGACCAAGAGATGCCAAGTTATTCTCGAGAATAACTTGGCATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-995s21c1
Sequence:CCGGACTAATGTTTGATGCCAATTTCTCGAGAAATTGGCATCAAACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020682
AS3MT MISSION shRNA Lentiviral Transduction Particles
arsenic (+3 oxidation state) methyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-449s1c1
Sequence:CCGGCCAGGCATCTAATGTGACTTTCTCGAGAAAGTCACATTAGATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-643s1c1
Sequence:CCGGGCCTTGAACTGCCAGAAGAAACTCGAGTTTCTTCTGGCAGTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-322s1c1
Sequence:CCGGGCAGAGATTGCTATGTACTTACTCGAGTAAGTACATAGCAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-930s1c1
Sequence:CCGGGAACTAATGTTTGATGCCAATCTCGAGATTGGCATCAAACATTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020682.2-561s1c1
Sequence:CCGGCCTGATAAACAACAAGTGCTTCTCGAGAAGCACTTGTTGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-612s21c1
Sequence:CCGGATTAACCTTGTGCCTGATAAACTCGAGTTTATCAGGCACAAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-942s21c1
Sequence:CCGGACCAAGAGATGCCAAGTTATTCTCGAGAATAACTTGGCATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020682.3-995s21c1
Sequence:CCGGACTAATGTTTGATGCCAATTTCTCGAGAAATTGGCATCAAACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks