EMAIL THIS PAGE TO A FRIEND

ASAH1

N-acylsphingosine amidohydrolase (acid ceramidase) 1

81 Gene Product Result for
Synonyms: AC ACDase ASAH PHP PHP32 SMAPME
UniProtKB ID: Q13510, E9PDS0, Q6W898, Q96AS2
Gene ID:
Human(427) Summary: This gene encodes a heterodimeric protein consisting of a nonglycosylated alpha subunit and a glycosylated beta subunit that is cleaved to the mature enzyme posttranslationally. The encoded protein catalyzes the synthesis and degradation of ceramide into sphingosine and fatty acid. Mutations in this gene have been associated with a lysosomal storage disorder known as Farber disease. Multiple transcript variants encoding several distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(11886) N-acylsphingosine amidohydrolase 1
Rat(84431) N-acylsphingosine amidohydrolase (acid ceramidase) 1
chicken(422727) N-acylsphingosine amidohydrolase (acid ceramidase) 1
cow(510620) N-acylsphingosine amidohydrolase (acid ceramidase) 1
domestic cat(101082231) N-acylsphingosine amidohydrolase (acid ceramidase) 1
dog(482897) N-acylsphingosine amidohydrolase (acid ceramidase) 1
naked mole-rat(101724913) N-acylsphingosine amidohydrolase (acid ceramidase) 1
domestic guinea pig(100735549) N-acylsphingosine amidohydrolase (acid ceramidase) 1
sheep(101117904) N-acylsphingosine amidohydrolase (acid ceramidase) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004315 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064111 MISSION® esiRNA esiRNA human ASAH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127505 Rosetta Predictions human pricing
NM_004315 Rosetta Predictions human pricing
NM_177924 Rosetta Predictions human pricing
NM_053407 Rosetta Predictions rat pricing
NM_019734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329714 predicted 824
2 SASI_Hs02_00329715 predicted 704
3 SASI_Hs02_00329716 predicted 803
4 SASI_Hs02_00329717 predicted 1068
5 SASI_Hs02_00329718 predicted 1286
6 SASI_Hs02_00329719 predicted 1133
7 SASI_Hs02_00329720 predicted 1115
8 SASI_Hs02_00329721 predicted 854
9 SASI_Hs02_00329722 predicted 772
10 SASI_Hs02_00329723 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337343 predicted 891
2 SASI_Hs01_00026983 predicted 768
3 SASI_Hs01_00026984 predicted 865
4 SASI_Hs01_00026985 predicted 1136
5 SASI_Hs01_00026986 predicted 1351
6 SASI_Hs01_00026988 predicted 1191
7 SASI_Hs02_00337344 predicted 1182
8 SASI_Hs01_00026990 predicted 916
9 SASI_Hs02_00337345 predicted 837
10 SASI_Hs02_00337346 predicted 1261
11 SASI_Hs01_00026981 predicted 1008
12 SASI_Hs01_00026982 predicted 590
13 SASI_Hs01_00026987 predicted 704
14 SASI_Hs01_00026989 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369409 predicted 954
2 SASI_Hs01_00146318 predicted 832
3 SASI_Hs01_00146319 predicted 929
4 SASI_Hs01_00146320 predicted 1204
5 SASI_Hs01_00146321 predicted 1420
6 SASI_Hs01_00146323 predicted 1260
7 SASI_Hs02_00369410 predicted 1250
8 SASI_Hs01_00146325 predicted 989
9 SASI_Hs02_00369411 predicted 905
10 SASI_Hs02_00369412 predicted 1322
11 SASI_Hs01_00146316 predicted 849
12 SASI_Hs01_00146317 predicted 422
13 SASI_Hs01_00146322 predicted 541
14 SASI_Hs01_00146324 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265919 predicted 830
2 SASI_Rn02_00265920 predicted 264
3 SASI_Rn02_00265921 predicted 203
4 SASI_Rn02_00265922 predicted 901
5 SASI_Rn02_00265923 predicted 780
6 SASI_Rn02_00265924 predicted 275
7 SASI_Rn02_00265925 predicted 777
8 SASI_Rn02_00265926 predicted 954
9 SASI_Rn02_00265927 predicted 1153
10 SASI_Rn02_00265928 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117601 predicted 294
2 SASI_Mm01_00117602 predicted 1228
3 SASI_Mm01_00117604 predicted 787
4 SASI_Mm02_00324878 predicted 1220
5 SASI_Mm01_00117606 predicted 795
6 SASI_Mm01_00117607 predicted 1029
7 SASI_Mm01_00117608 predicted 979
8 SASI_Mm01_00117610 predicted 736
9 SASI_Mm01_00117609 predicted 593
10 SASI_Mm02_00324879 predicted 341
11 SASI_Mm01_00117603 predicted 984
12 SASI_Mm01_00117605 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019734
VALIDATED
ASAH1 MISSION shRNA Bacterial Glycerol Stock
N-acylsphingosine amidohydrolase (acid ceramidase) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-532s21c1
Sequence:CCGGCCATGTGTACATCAATCATAACTCGAGTTATGATTGATGTACACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-257s21c1
Sequence:CCGGGCACACCATAAATCTTGATTTCTCGAGAAATCAAGATTTATGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019734.2-1417s21c1
Sequence:CCGGCCTCATCATGTTACATTGTTTCTCGAGAAACAATGTAACATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-187s21c1
Sequence:CCGGCGTGGACAGAAGATTGCAGAACTCGAGTTCTGCAATCTTCTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-1233s21c1
Sequence:CCGGGATGTTACCAAAGGTCAATTTCTCGAGAAATTGACCTTTGGTAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019734.1-1347s1c1
Sequence:CCGGCCTCATCATGTTACATTGTTTCTCGAGAAACAATGTAACATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-1095s1c1
Sequence:CCGGCTACCATCTATGATGTCCTATCTCGAGATAGGACATCATAGATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019734.1-117s1c1
Sequence:CCGGCGTGGACAGAAGATTGCAGAACTCGAGTTCTGCAATCTTCTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-187s1c1
Sequence:CCGGGCACACCATAAATCTTGATTTCTCGAGAAATCAAGATTTATGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-1046s1c1
Sequence:CCGGCCGGCCAAGAAGTGTCTAAATCTCGAGATTTAGACACTTCTTGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019734
VALIDATED
ASAH1 MISSION shRNA shRNA Plasmid DNA
N-acylsphingosine amidohydrolase (acid ceramidase) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-532s21c1
Sequence:CCGGCCATGTGTACATCAATCATAACTCGAGTTATGATTGATGTACACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-257s21c1
Sequence:CCGGGCACACCATAAATCTTGATTTCTCGAGAAATCAAGATTTATGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019734.2-1417s21c1
Sequence:CCGGCCTCATCATGTTACATTGTTTCTCGAGAAACAATGTAACATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-187s21c1
Sequence:CCGGCGTGGACAGAAGATTGCAGAACTCGAGTTCTGCAATCTTCTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-1233s21c1
Sequence:CCGGGATGTTACCAAAGGTCAATTTCTCGAGAAATTGACCTTTGGTAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019734.1-1347s1c1
Sequence:CCGGCCTCATCATGTTACATTGTTTCTCGAGAAACAATGTAACATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-1095s1c1
Sequence:CCGGCTACCATCTATGATGTCCTATCTCGAGATAGGACATCATAGATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019734.1-117s1c1
Sequence:CCGGCGTGGACAGAAGATTGCAGAACTCGAGTTCTGCAATCTTCTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-187s1c1
Sequence:CCGGGCACACCATAAATCTTGATTTCTCGAGAAATCAAGATTTATGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-1046s1c1
Sequence:CCGGCCGGCCAAGAAGTGTCTAAATCTCGAGATTTAGACACTTCTTGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019734
VALIDATED
ASAH1 MISSION shRNA Lentiviral Transduction Particles
N-acylsphingosine amidohydrolase (acid ceramidase) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-532s21c1
Sequence:CCGGCCATGTGTACATCAATCATAACTCGAGTTATGATTGATGTACACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-257s21c1
Sequence:CCGGGCACACCATAAATCTTGATTTCTCGAGAAATCAAGATTTATGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019734.2-1417s21c1
Sequence:CCGGCCTCATCATGTTACATTGTTTCTCGAGAAACAATGTAACATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-187s21c1
Sequence:CCGGCGTGGACAGAAGATTGCAGAACTCGAGTTCTGCAATCTTCTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019734.2-1233s21c1
Sequence:CCGGGATGTTACCAAAGGTCAATTTCTCGAGAAATTGACCTTTGGTAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019734.1-1347s1c1
Sequence:CCGGCCTCATCATGTTACATTGTTTCTCGAGAAACAATGTAACATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-1095s1c1
Sequence:CCGGCTACCATCTATGATGTCCTATCTCGAGATAGGACATCATAGATGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019734.1-117s1c1
Sequence:CCGGCGTGGACAGAAGATTGCAGAACTCGAGTTCTGCAATCTTCTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-187s1c1
Sequence:CCGGGCACACCATAAATCTTGATTTCTCGAGAAATCAAGATTTATGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019734.1-1046s1c1
Sequence:CCGGCCGGCCAAGAAGTGTCTAAATCTCGAGATTTAGACACTTCTTGGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004315
VALIDATED
ASAH1 MISSION shRNA Bacterial Glycerol Stock
N-acylsphingosine amidohydrolase (acid ceramidase) 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-1927s21c1
Sequence:CCGGCTGTTATTGACAGCGATATAACTCGAGTTATATCGCTGTCAATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-773s21c1
Sequence:GTACCGGGGTCATAACTGAGCAACTAAACTCGAGTTTAGTTGCTCAGTTATGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-384s21c1
Sequence:GTACCGGGTTCCATGGTACACCATAAATCTCGAGATTTATGGTGTACCATGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-601s21c1
Sequence:CCGGTTGCCGCTGTTACTGATATACCTCGAGGTATATCAGTAACAGCGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004315.2-1894s1c1
Sequence:CCGGGCTGTTATTGACAGCGATATACTCGAGTATATCGCTGTCAATAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004315.2-1220s1c1
Sequence:CCGGGCCTGCAAAGATGTGTCTGAACTCGAGTTCAGACACATCTTTGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004315.2-576s1c1
Sequence:CCGGGCTGTTACTGATATACCTTTACTCGAGTAAAGGTATATCAGTAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004315.2-1108s1c1
Sequence:CCGGGAAAGGAATCATTGGATGTATCTCGAGATACATCCAATGATTCCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004315.2-423s1c1
Sequence:CCGGGCACCAATGCTAAAGGTTATACTCGAGTATAACCTTTAGCATTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004315
VALIDATED
ASAH1 MISSION shRNA shRNA Plasmid DNA
N-acylsphingosine amidohydrolase (acid ceramidase) 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-1927s21c1
Sequence:CCGGCTGTTATTGACAGCGATATAACTCGAGTTATATCGCTGTCAATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-773s21c1
Sequence:GTACCGGGGTCATAACTGAGCAACTAAACTCGAGTTTAGTTGCTCAGTTATGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-384s21c1
Sequence:GTACCGGGTTCCATGGTACACCATAAATCTCGAGATTTATGGTGTACCATGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-601s21c1
Sequence:CCGGTTGCCGCTGTTACTGATATACCTCGAGGTATATCAGTAACAGCGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004315.2-1894s1c1
Sequence:CCGGGCTGTTATTGACAGCGATATACTCGAGTATATCGCTGTCAATAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004315.2-1220s1c1
Sequence:CCGGGCCTGCAAAGATGTGTCTGAACTCGAGTTCAGACACATCTTTGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004315.2-576s1c1
Sequence:CCGGGCTGTTACTGATATACCTTTACTCGAGTAAAGGTATATCAGTAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004315.2-1108s1c1
Sequence:CCGGGAAAGGAATCATTGGATGTATCTCGAGATACATCCAATGATTCCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004315.2-423s1c1
Sequence:CCGGGCACCAATGCTAAAGGTTATACTCGAGTATAACCTTTAGCATTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004315
VALIDATED
ASAH1 MISSION shRNA Lentiviral Transduction Particles
N-acylsphingosine amidohydrolase (acid ceramidase) 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-1927s21c1
Sequence:CCGGCTGTTATTGACAGCGATATAACTCGAGTTATATCGCTGTCAATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-773s21c1
Sequence:GTACCGGGGTCATAACTGAGCAACTAAACTCGAGTTTAGTTGCTCAGTTATGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-384s21c1
Sequence:GTACCGGGTTCCATGGTACACCATAAATCTCGAGATTTATGGTGTACCATGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004315.4-601s21c1
Sequence:CCGGTTGCCGCTGTTACTGATATACCTCGAGGTATATCAGTAACAGCGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004315.2-1894s1c1
Sequence:CCGGGCTGTTATTGACAGCGATATACTCGAGTATATCGCTGTCAATAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004315.2-1220s1c1
Sequence:CCGGGCCTGCAAAGATGTGTCTGAACTCGAGTTCAGACACATCTTTGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004315.2-576s1c1
Sequence:CCGGGCTGTTACTGATATACCTTTACTCGAGTAAAGGTATATCAGTAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004315.2-1108s1c1
Sequence:CCGGGAAAGGAATCATTGGATGTATCTCGAGATACATCCAATGATTCCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004315.2-423s1c1
Sequence:CCGGGCACCAATGCTAAAGGTTATACTCGAGTATAACCTTTAGCATTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)