EMAIL THIS PAGE TO A FRIEND

ASAH2

N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2

51 Gene Product Result for
Synonyms: BCDase HNAC1 LCDase N-CDase NCDase
Gene ID:
Human(56624) Summary: Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]
Mouse(54447) N-acylsphingosine amidohydrolase 2
Rat(114104) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Zebrafish(493602) N-acylsphingosine amidohydrolase 2
chicken(423679) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
dog(486461) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Horse(100071829) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
cow(615837) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
cow(100336736) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
domestic cat(101097670) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
sheep(101121732) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Domestic Rabbit(100357673) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
domestic guinea pig(100728346) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
naked mole-rat(101709668) N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019893 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019893 Rosetta Predictions human pricing
NM_053646 Rosetta Predictions rat pricing
NM_018830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045220 predicted 397
2 SASI_Hs01_00045221 predicted 1763
3 SASI_Hs02_00352907 predicted 1108
4 SASI_Hs01_00045222 predicted 1704
5 SASI_Hs01_00045223 predicted 1662
6 SASI_Hs01_00045224 predicted 1628
7 SASI_Hs01_00045225 predicted 859
8 SASI_Hs02_00352908 predicted 1746
9 SASI_Hs01_00045226 predicted 283
10 SASI_Hs01_00045228 predicted 1773
11 SASI_Hs01_00045219 predicted 1060
12 SASI_Hs01_00045227 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041904 predicted 1942
2 SASI_Rn01_00041905 predicted 1197
3 SASI_Rn01_00041906 predicted 2197
4 SASI_Rn01_00041907 predicted 1068
5 SASI_Rn02_00266369 predicted 534
6 SASI_Rn02_00266370 predicted 2015
7 SASI_Rn01_00041909 predicted 1502
8 SASI_Rn01_00041911 predicted 1722
9 SASI_Rn01_00041912 predicted 1733
10 SASI_Rn01_00041913 predicted 788
11 SASI_Rn01_00041908 predicted 1683
12 SASI_Rn01_00041910 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020466 predicted 1551
2 SASI_Mm01_00020467 predicted 2093
3 SASI_Mm01_00020468 predicted 2305
4 SASI_Mm01_00020469 predicted 1299
5 SASI_Mm02_00324185 predicted 2457
6 SASI_Mm01_00020470 predicted 1246
7 SASI_Mm01_00020473 predicted 2199
8 SASI_Mm01_00020474 predicted 1427
9 SASI_Mm02_00324186 predicted 1146
10 SASI_Mm01_00020475 predicted 2310
11 SASI_Mm01_00020471 predicted 1202
12 SASI_Mm01_00020472 predicted 2069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018830
VALIDATED
ASAH2 MISSION shRNA Bacterial Glycerol Stock
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-3122s1c1
Sequence:CCGGCCCTGAAATATAATGACAGTACTCGAGTACTGTCATTATATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018830.1-838s1c1
Sequence:CCGGGCGTGGAACTATGTATGATTTCTCGAGAAATCATACATAGTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-2652s1c1
Sequence:CCGGCCCGCTGTCATACTAGCATTTCTCGAGAAATGCTAGTATGACAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-1057s1c1
Sequence:CCGGGCATTGATATAGCTCACACAACTCGAGTTGTGTGAGCTATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-2075s1c1
Sequence:CCGGCGCAGGTCTAAGCAATGTTTACTCGAGTAAACATTGCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-1057s21c1
Sequence:CCGGGCATTGATATAGCTCACACAACTCGAGTTGTGTGAGCTATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-2652s21c1
Sequence:CCGGCCCGCTGTCATACTAGCATTTCTCGAGAAATGCTAGTATGACAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-838s21c1
Sequence:CCGGGCGTGGAACTATGTATGATTTCTCGAGAAATCATACATAGTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-2075s21c2
Sequence:CCGGCGCAGGTCTAAGCAATGTTTACTCGAGTAAACATTGCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018830.1-3122s21c1
Sequence:CCGGCCCTGAAATATAATGACAGTACTCGAGTACTGTCATTATATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018830
VALIDATED
ASAH2 MISSION shRNA shRNA Plasmid DNA
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-3122s1c1
Sequence:CCGGCCCTGAAATATAATGACAGTACTCGAGTACTGTCATTATATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018830.1-838s1c1
Sequence:CCGGGCGTGGAACTATGTATGATTTCTCGAGAAATCATACATAGTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-2652s1c1
Sequence:CCGGCCCGCTGTCATACTAGCATTTCTCGAGAAATGCTAGTATGACAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-1057s1c1
Sequence:CCGGGCATTGATATAGCTCACACAACTCGAGTTGTGTGAGCTATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-2075s1c1
Sequence:CCGGCGCAGGTCTAAGCAATGTTTACTCGAGTAAACATTGCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-1057s21c1
Sequence:CCGGGCATTGATATAGCTCACACAACTCGAGTTGTGTGAGCTATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-2652s21c1
Sequence:CCGGCCCGCTGTCATACTAGCATTTCTCGAGAAATGCTAGTATGACAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-838s21c1
Sequence:CCGGGCGTGGAACTATGTATGATTTCTCGAGAAATCATACATAGTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-2075s21c2
Sequence:CCGGCGCAGGTCTAAGCAATGTTTACTCGAGTAAACATTGCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018830.1-3122s21c1
Sequence:CCGGCCCTGAAATATAATGACAGTACTCGAGTACTGTCATTATATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018830
VALIDATED
ASAH2 MISSION shRNA Lentiviral Transduction Particles
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-3122s1c1
Sequence:CCGGCCCTGAAATATAATGACAGTACTCGAGTACTGTCATTATATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018830.1-838s1c1
Sequence:CCGGGCGTGGAACTATGTATGATTTCTCGAGAAATCATACATAGTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-2652s1c1
Sequence:CCGGCCCGCTGTCATACTAGCATTTCTCGAGAAATGCTAGTATGACAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-1057s1c1
Sequence:CCGGGCATTGATATAGCTCACACAACTCGAGTTGTGTGAGCTATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018830.1-2075s1c1
Sequence:CCGGCGCAGGTCTAAGCAATGTTTACTCGAGTAAACATTGCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-1057s21c1
Sequence:CCGGGCATTGATATAGCTCACACAACTCGAGTTGTGTGAGCTATATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-2652s21c1
Sequence:CCGGCCCGCTGTCATACTAGCATTTCTCGAGAAATGCTAGTATGACAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-838s21c1
Sequence:CCGGGCGTGGAACTATGTATGATTTCTCGAGAAATCATACATAGTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018830.1-2075s21c2
Sequence:CCGGCGCAGGTCTAAGCAATGTTTACTCGAGTAAACATTGCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018830.1-3122s21c1
Sequence:CCGGCCCTGAAATATAATGACAGTACTCGAGTACTGTCATTATATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019893
ASAH2 MISSION shRNA Bacterial Glycerol Stock
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-413s1c1
Sequence:CCGGGCATCGACATAGGCATGGTATCTCGAGATACCATGCCTATGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1743s1c1
Sequence:CCGGGCACGCATTATCTGCTTACATCTCGAGATGTAAGCAGATAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1083s1c1
Sequence:CCGGGCCTAGCATGTGCATTGCTAACTCGAGTTAGCAATGCACATGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1315s1c1
Sequence:CCGGGCTGGCACTATTGATGGAGTTCTCGAGAACTCCATCAATAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-876s1c1
Sequence:CCGGCCATCTTGTAAACAGTGACAACTCGAGTTGTCACTGTTTACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019893.2-396s21c1
Sequence:CCGGCATCCTCACCAGGCTATACAGCTCGAGCTGTATAGCCTGGTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019893.2-123s21c1
Sequence:CCGGCAAAGATTTAGGAGGCCATTTCTCGAGAAATGGCCTCCTAAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019893
ASAH2 MISSION shRNA shRNA Plasmid DNA
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-413s1c1
Sequence:CCGGGCATCGACATAGGCATGGTATCTCGAGATACCATGCCTATGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1743s1c1
Sequence:CCGGGCACGCATTATCTGCTTACATCTCGAGATGTAAGCAGATAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1083s1c1
Sequence:CCGGGCCTAGCATGTGCATTGCTAACTCGAGTTAGCAATGCACATGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1315s1c1
Sequence:CCGGGCTGGCACTATTGATGGAGTTCTCGAGAACTCCATCAATAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-876s1c1
Sequence:CCGGCCATCTTGTAAACAGTGACAACTCGAGTTGTCACTGTTTACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019893.2-396s21c1
Sequence:CCGGCATCCTCACCAGGCTATACAGCTCGAGCTGTATAGCCTGGTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019893.2-123s21c1
Sequence:CCGGCAAAGATTTAGGAGGCCATTTCTCGAGAAATGGCCTCCTAAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019893
ASAH2 MISSION shRNA Lentiviral Transduction Particles
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-413s1c1
Sequence:CCGGGCATCGACATAGGCATGGTATCTCGAGATACCATGCCTATGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1743s1c1
Sequence:CCGGGCACGCATTATCTGCTTACATCTCGAGATGTAAGCAGATAATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1083s1c1
Sequence:CCGGGCCTAGCATGTGCATTGCTAACTCGAGTTAGCAATGCACATGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-1315s1c1
Sequence:CCGGGCTGGCACTATTGATGGAGTTCTCGAGAACTCCATCAATAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019893.1-876s1c1
Sequence:CCGGCCATCTTGTAAACAGTGACAACTCGAGTTGTCACTGTTTACAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019893.2-396s21c1
Sequence:CCGGCATCCTCACCAGGCTATACAGCTCGAGCTGTATAGCCTGGTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019893.2-123s21c1
Sequence:CCGGCAAAGATTTAGGAGGCCATTTCTCGAGAAATGGCCTCCTAAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks