EMAIL THIS PAGE TO A FRIEND

ASAH2B

N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B

44 Gene Product Result for
Synonyms: ASAH2C ASAH2L bA449O16.3
Species: Human ASAH2B(653308)
UniProtKB ID: P0C7U1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079516 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117931 MISSION® esiRNA esiRNA human ASAH2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079516 Rosetta Predictions human pricing
XM_928675 Rosetta Predictions human pricing
XM_933039 Rosetta Predictions human pricing
XM_933044 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313400 predicted 332
2 SASI_Hs02_00313401 predicted 407
3 SASI_Hs02_00313402 predicted 331
4 SASI_Hs02_00313403 predicted 304
5 SASI_Hs02_00313404 predicted 352
6 SASI_Hs02_00313405 predicted 311
7 SASI_Hs02_00313406 predicted 283
8 SASI_Hs02_00313407 predicted 291
9 SASI_Hs02_00313408 predicted 331
10 SASI_Hs02_00313409 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285640 predicted 1112
2 SASI_Hs01_00285641 predicted 1593
3 SASI_Hs01_00285642 predicted 1538
4 SASI_Hs01_00285643 predicted 1677
5 SASI_Hs01_00285644 predicted 1580
6 SASI_Hs01_00285645 predicted 1305
7 SASI_Hs01_00285646 predicted 1793
8 SASI_Hs01_00285647 predicted 1501
9 SASI_Hs01_00285648 predicted 1806
10 SASI_Hs01_00285649 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258933 predicted 602
2 SASI_Hs01_00258934 predicted 594
3 SASI_Hs01_00258935 predicted 656
4 SASI_Hs01_00258936 predicted 603
5 SASI_Hs01_00258937 predicted 609
6 SASI_Hs01_00258938 predicted 576
7 SASI_Hs01_00258939 predicted 600
8 SASI_Hs01_00258940 predicted 635
9 SASI_Hs01_00258941 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269240 predicted 663
2 SASI_Hs01_00269241 predicted 612
3 SASI_Hs01_00269242 predicted 747
4 SASI_Hs01_00269243 predicted 658
5 SASI_Hs01_00269244 predicted 367
6 SASI_Hs01_00269245 predicted 869
7 SASI_Hs01_00269246 predicted 565
8 SASI_Hs01_00269247 predicted 879
9 SASI_Hs01_00269248 predicted 398
10 SASI_Hs01_00269249 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079516
VALIDATED
ASAH2B MISSION shRNA Bacterial Glycerol Stock
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-390s21c1
Sequence:CCGGGGACTCCTGGGTCTGAGTAATCTCGAGATTACTCAGACCCAGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-96s21c1
Sequence:CCGGACGCATTATCTGCTTACATTCCTCGAGGAATGTAAGCAGATAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-135s21c1
Sequence:CCGGCTAAGGCTATTGCTACGTATTCTCGAGAATACGTAGCAATAGCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001079516.1-412s21c1
Sequence:CCGGCAACAGTGGAATGGCATATTCCTCGAGGAATATGCCATTCCACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-227s21c1
Sequence:CCGGGGAAGTTGCTGAAGTTATATTCTCGAGAATATAACTTCAGCAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079516
VALIDATED
ASAH2B MISSION shRNA shRNA Plasmid DNA
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-390s21c1
Sequence:CCGGGGACTCCTGGGTCTGAGTAATCTCGAGATTACTCAGACCCAGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-96s21c1
Sequence:CCGGACGCATTATCTGCTTACATTCCTCGAGGAATGTAAGCAGATAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-135s21c1
Sequence:CCGGCTAAGGCTATTGCTACGTATTCTCGAGAATACGTAGCAATAGCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001079516.1-412s21c1
Sequence:CCGGCAACAGTGGAATGGCATATTCCTCGAGGAATATGCCATTCCACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-227s21c1
Sequence:CCGGGGAAGTTGCTGAAGTTATATTCTCGAGAATATAACTTCAGCAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079516
VALIDATED
ASAH2B MISSION shRNA Lentiviral Transduction Particles
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-390s21c1
Sequence:CCGGGGACTCCTGGGTCTGAGTAATCTCGAGATTACTCAGACCCAGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-96s21c1
Sequence:CCGGACGCATTATCTGCTTACATTCCTCGAGGAATGTAAGCAGATAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-135s21c1
Sequence:CCGGCTAAGGCTATTGCTACGTATTCTCGAGAATACGTAGCAATAGCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001079516.1-412s21c1
Sequence:CCGGCAACAGTGGAATGGCATATTCCTCGAGGAATATGCCATTCCACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079516.1-227s21c1
Sequence:CCGGGGAAGTTGCTGAAGTTATATTCTCGAGAATATAACTTCAGCAACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks