EMAIL THIS PAGE TO A FRIEND

ASAP1

ArfGAP with SH3 domain, ankyrin repeat and PH domain 1

Synonyms: AMAP1 CENTB4 DDEF1 PAG2 PAP ZG14P
UniProtKB ID: Q9ULH1, B2RNV3
Gene ID:
Human(50807) Summary: This gene encodes an ADP-ribosylation factor (ARF) GTPase-activating protein. The GTPase-activating activity is stimulated by phosphatidylinositol 4,5-biphosphate (PIP2), and is greater towards ARF1 and ARF5, and lesser for ARF6. This gene maybe involved in regulation of membrane trafficking and cytoskeleton remodeling. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(13196) ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Rat(314961) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Zebrafish(561879) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
dog(482044) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
cow(327705) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Horse(100068654) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
domestic cat(101091998) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
chicken(428385) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
fruit fly(35783) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
naked mole-rat(101698673) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
domestic guinea pig(100722888) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
sheep(101122198) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Domestic Rabbit(100359279) ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018482 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018482 Rosetta Predictions human pricing
NM_001044245 Rosetta Predictions rat pricing
NM_010026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020022 predicted 2739
2 SASI_Hs01_00020023 predicted 497
3 SASI_Hs01_00020024 predicted 308
4 SASI_Hs01_00020025 predicted 2718
5 SASI_Hs01_00020027 predicted 1418
6 SASI_Hs01_00020028 predicted 1730
7 SASI_Hs01_00020029 predicted 487
8 SASI_Hs02_00352071 predicted 2160
9 SASI_Hs01_00020031 predicted 1229
10 SASI_Hs02_00352072 predicted 1233
11 SASI_Hs01_00020026 predicted 984
12 SASI_Hs01_00020030 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205177 predicted 277
2 SASI_Rn02_00205178 predicted 1191
3 SASI_Rn02_00205179 predicted 1636
4 SASI_Rn02_00205180 predicted 289
5 SASI_Rn02_00205181 predicted 480
6 SASI_Rn02_00205182 predicted 2723
7 SASI_Rn02_00205183 predicted 2069
8 SASI_Rn02_00205184 predicted 1792
9 SASI_Rn02_00205185 predicted 1757
10 SASI_Rn02_00205186 predicted 3038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165714 predicted 516
2 SASI_Mm01_00165715 predicted 1423
3 SASI_Mm01_00165716 predicted 3040
4 SASI_Mm02_00317675 predicted 2258
5 SASI_Mm01_00165718 predicted 521
6 SASI_Mm01_00165719 predicted 710
7 SASI_Mm01_00165720 predicted 2856
8 SASI_Mm02_00317676 predicted 1948
9 SASI_Mm01_00165721 predicted 1759
10 SASI_Mm01_00165723 predicted 2969
11 SASI_Mm01_00165717 predicted 3522
12 SASI_Mm01_00165722 predicted 1663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010026
VALIDATED
ASAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-1993s21c1
Sequence:CCGGCCAGGGACTTACTTGCATTAACTCGAGTTAATGCAAGTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-516s21c1
Sequence:CCGGGCACAAGTTCTGGATAAGTTTCTCGAGAAACTTATCCAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-4021s21c1
Sequence:CCGGCAGTACCGACTCCTAACAATGCTCGAGCATTGTTAGGAGTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-933s21c1
Sequence:CCGGGACCTGCTGCAGAACCTTATACTCGAGTATAAGGTTCTGCAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-880s21c1
Sequence:CCGGAGATGTGTGAATATCTCATTACTCGAGTAATGAGATATTCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010026.2-3621s1c1
Sequence:CCGGCCTGAAAGGAAGGGTGTCTTTCTCGAGAAAGACACCCTTCCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-4332s1c1
Sequence:CCGGCCTGAGATATTACCTCATTATCTCGAGATAATGAGGTAATATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-516s1c1
Sequence:CCGGGCACAAGTTCTGGATAAGTTTCTCGAGAAACTTATCCAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-723s1c1
Sequence:CCGGCCATTTGACAAAGCCTGGAAACTCGAGTTTCCAGGCTTTGTCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-1993s1c1
Sequence:CCGGCCAGGGACTTACTTGCATTAACTCGAGTTAATGCAAGTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010026
VALIDATED
ASAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-1993s21c1
Sequence:CCGGCCAGGGACTTACTTGCATTAACTCGAGTTAATGCAAGTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-516s21c1
Sequence:CCGGGCACAAGTTCTGGATAAGTTTCTCGAGAAACTTATCCAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-4021s21c1
Sequence:CCGGCAGTACCGACTCCTAACAATGCTCGAGCATTGTTAGGAGTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-933s21c1
Sequence:CCGGGACCTGCTGCAGAACCTTATACTCGAGTATAAGGTTCTGCAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-880s21c1
Sequence:CCGGAGATGTGTGAATATCTCATTACTCGAGTAATGAGATATTCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010026.2-3621s1c1
Sequence:CCGGCCTGAAAGGAAGGGTGTCTTTCTCGAGAAAGACACCCTTCCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-4332s1c1
Sequence:CCGGCCTGAGATATTACCTCATTATCTCGAGATAATGAGGTAATATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-516s1c1
Sequence:CCGGGCACAAGTTCTGGATAAGTTTCTCGAGAAACTTATCCAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-723s1c1
Sequence:CCGGCCATTTGACAAAGCCTGGAAACTCGAGTTTCCAGGCTTTGTCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-1993s1c1
Sequence:CCGGCCAGGGACTTACTTGCATTAACTCGAGTTAATGCAAGTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010026
VALIDATED
ASAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-1993s21c1
Sequence:CCGGCCAGGGACTTACTTGCATTAACTCGAGTTAATGCAAGTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-516s21c1
Sequence:CCGGGCACAAGTTCTGGATAAGTTTCTCGAGAAACTTATCCAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-4021s21c1
Sequence:CCGGCAGTACCGACTCCTAACAATGCTCGAGCATTGTTAGGAGTCGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-933s21c1
Sequence:CCGGGACCTGCTGCAGAACCTTATACTCGAGTATAAGGTTCTGCAGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010026.2-880s21c1
Sequence:CCGGAGATGTGTGAATATCTCATTACTCGAGTAATGAGATATTCACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010026.2-3621s1c1
Sequence:CCGGCCTGAAAGGAAGGGTGTCTTTCTCGAGAAAGACACCCTTCCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-4332s1c1
Sequence:CCGGCCTGAGATATTACCTCATTATCTCGAGATAATGAGGTAATATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-516s1c1
Sequence:CCGGGCACAAGTTCTGGATAAGTTTCTCGAGAAACTTATCCAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-723s1c1
Sequence:CCGGCCATTTGACAAAGCCTGGAAACTCGAGTTTCCAGGCTTTGTCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010026.2-1993s1c1
Sequence:CCGGCCAGGGACTTACTTGCATTAACTCGAGTTAATGCAAGTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018482
VALIDATED
ASAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-1746s21c1
Sequence:CCGGCCAGGGATTTACTTGCACTAACTCGAGTTAGTGCAAGTAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-325s21c1
Sequence:CCGGTGATAAGTTTGGGAGTAATTTCTCGAGAAATTACTCCCAAACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-61s21c1
Sequence:CCGGTTCGTCGAGAGATTCACTATGCTCGAGCATAGTGAATCTCTCGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-3771s21c1
Sequence:CCGGTTGACTCTGTTCCTAACAATGCTCGAGCATTGTTAGGAACAGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-1547s21c1
Sequence:CCGGGCCAAGAATGTAGGAAACAATCTCGAGATTGTTTCCTACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018482.2-4720s1c1
Sequence:CCGGGCCATGTTTATCAGATCCTTACTCGAGTAAGGATCTGATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-1736s1c1
Sequence:CCGGGCCATCAAATCCAGGGATTTACTCGAGTAAATCCCTGGATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-1547s1c1
Sequence:CCGGGCCAAGAATGTAGGAAACAATCTCGAGATTGTTTCCTACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-2619s1c1
Sequence:CCGGCCTCTTCAAGTAAGACTACAACTCGAGTTGTAGTCTTACTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018482.2-1746s1c1
Sequence:CCGGCCAGGGATTTACTTGCACTAACTCGAGTTAGTGCAAGTAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018482
VALIDATED
ASAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-1746s21c1
Sequence:CCGGCCAGGGATTTACTTGCACTAACTCGAGTTAGTGCAAGTAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-325s21c1
Sequence:CCGGTGATAAGTTTGGGAGTAATTTCTCGAGAAATTACTCCCAAACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-61s21c1
Sequence:CCGGTTCGTCGAGAGATTCACTATGCTCGAGCATAGTGAATCTCTCGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-3771s21c1
Sequence:CCGGTTGACTCTGTTCCTAACAATGCTCGAGCATTGTTAGGAACAGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-1547s21c1
Sequence:CCGGGCCAAGAATGTAGGAAACAATCTCGAGATTGTTTCCTACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018482.2-4720s1c1
Sequence:CCGGGCCATGTTTATCAGATCCTTACTCGAGTAAGGATCTGATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-1736s1c1
Sequence:CCGGGCCATCAAATCCAGGGATTTACTCGAGTAAATCCCTGGATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-1547s1c1
Sequence:CCGGGCCAAGAATGTAGGAAACAATCTCGAGATTGTTTCCTACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-2619s1c1
Sequence:CCGGCCTCTTCAAGTAAGACTACAACTCGAGTTGTAGTCTTACTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018482.2-1746s1c1
Sequence:CCGGCCAGGGATTTACTTGCACTAACTCGAGTTAGTGCAAGTAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018482
VALIDATED
ASAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-1746s21c1
Sequence:CCGGCCAGGGATTTACTTGCACTAACTCGAGTTAGTGCAAGTAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-325s21c1
Sequence:CCGGTGATAAGTTTGGGAGTAATTTCTCGAGAAATTACTCCCAAACTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-61s21c1
Sequence:CCGGTTCGTCGAGAGATTCACTATGCTCGAGCATAGTGAATCTCTCGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-3771s21c1
Sequence:CCGGTTGACTCTGTTCCTAACAATGCTCGAGCATTGTTAGGAACAGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018482.2-1547s21c1
Sequence:CCGGGCCAAGAATGTAGGAAACAATCTCGAGATTGTTTCCTACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018482.2-4720s1c1
Sequence:CCGGGCCATGTTTATCAGATCCTTACTCGAGTAAGGATCTGATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-1736s1c1
Sequence:CCGGGCCATCAAATCCAGGGATTTACTCGAGTAAATCCCTGGATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-1547s1c1
Sequence:CCGGGCCAAGAATGTAGGAAACAATCTCGAGATTGTTTCCTACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018482.2-2619s1c1
Sequence:CCGGCCTCTTCAAGTAAGACTACAACTCGAGTTGTAGTCTTACTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018482.2-1746s1c1
Sequence:CCGGCCAGGGATTTACTTGCACTAACTCGAGTTAGTGCAAGTAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks