EMAIL THIS PAGE TO A FRIEND

ASAP2

ArfGAP with SH3 domain, ankyrin repeat and PH domain 2

110 Gene Product Result for
Synonyms: AMAP2 CENTB3 DDEF2 PAG3 PAP Pap-alpha SHAG1
UniProtKB ID: O43150, D6W4Y8
Gene ID:
Human(8853) Summary: This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(211914) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Rat(362719) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
chicken(768599) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
cow(618009) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Horse(100072516) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
domestic cat(101095974) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
dog(475659) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
sheep(101102555) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
domestic guinea pig(100726170) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
naked mole-rat(101721882) ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003887 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003887 Rosetta Predictions human pricing
NM_001108704 Rosetta Predictions rat pricing
NM_001004364 Rosetta Predictions mouse pricing
NM_001098168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237006 predicted 1984
2 SASI_Hs01_00237008 predicted 2119
3 SASI_Hs02_00336499 predicted 645
4 SASI_Hs01_00237009 predicted 2705
5 SASI_Hs01_00237010 predicted 1764
6 SASI_Hs01_00237013 predicted 1956
7 SASI_Hs01_00237014 predicted 1202
8 SASI_Hs01_00237015 predicted 1419
9 SASI_Hs02_00336500 predicted 1059
10 SASI_Hs02_00336501 predicted 576
11 SASI_Hs01_00237007 predicted 3392
12 SASI_Hs01_00237011 predicted 608
13 SASI_Hs01_00237012 predicted 2374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241255 predicted 1510
2 SASI_Rn02_00241256 predicted 806
3 SASI_Rn02_00241257 predicted 1227
4 SASI_Rn02_00241258 predicted 1000
5 SASI_Rn02_00241259 predicted 2370
6 SASI_Rn02_00241260 predicted 768
7 SASI_Rn02_00241261 predicted 1061
8 SASI_Rn02_00241262 predicted 1255
9 SASI_Rn02_00241263 predicted 1986
10 SASI_Rn02_00241264 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143724 predicted 2968
2 SASI_Mm02_00286539 predicted 1708
3 SASI_Mm02_00286540 predicted 1434
4 SASI_Mm02_00286541 predicted 1373
5 SASI_Mm01_00143729 predicted 455
6 SASI_Mm01_00143730 predicted 526
7 SASI_Mm01_00143731 predicted 2224
8 SASI_Mm01_00143732 predicted 899
9 SASI_Mm01_00143733 predicted 1767
10 SASI_Mm02_00286542 predicted 3124
11 SASI_Mm01_00143725 predicted 1117
12 SASI_Mm01_00143726 predicted 1085
13 SASI_Mm01_00143727 predicted 1141
14 SASI_Mm01_00143728 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301217 predicted 2982
2 SASI_Mm02_00301218 predicted 1722
3 SASI_Mm02_00301219 predicted 1448
4 SASI_Mm02_00301220 predicted 1380
5 SASI_Mm02_00301221 predicted 456
6 SASI_Mm02_00301222 predicted 527
7 SASI_Mm02_00301223 predicted 2227
8 SASI_Mm02_00301224 predicted 894
9 SASI_Mm02_00301225 predicted 1782
10 SASI_Mm02_00301226 predicted 3131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004364
VALIDATED
ASAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004364.1-4399s1c1
Sequence:CCGGCGCATCTGTATCATCGGTCTTCTCGAGAAGACCGATGATACAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004364.1-720s1c1
Sequence:CCGGGCCCTTTGATAAAGCTTGGAACTCGAGTTCCAAGCTTTATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004364.1-1345s1c1
Sequence:CCGGGAAATTATGGAGTGTTGCCTACTCGAGTAGGCAACACTCCATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004364.1-1305s1c1
Sequence:CCGGCGGCACTCTTGCCAAGAATATCTCGAGATATTCTTGGCAAGAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004364.1-1783s1c1
Sequence:CCGGGCCTCCATTGAGATAGCCAATCTCGAGATTGGCTATCTCAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004364.2-3496s21c1
Sequence:GTACCGGCTTAGCCCAATTCCGACATTGCTCGAGCAATGTCGGAATTGGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-2336s21c1
Sequence:GTACCGGCCCATGTTCACGTCGAGTATGCTCGAGCATACTCGACGTGAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-1430s21c1
Sequence:GTACCGGACGAACAAGAATGTCAGATATCTCGAGATATCTGACATTCTTGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-1482s21c1
Sequence:GTACCGGAGCTCTGAACAACGCCTTTAACTCGAGTTAAAGGCGTTGTTCAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-887s21c1
Sequence:GTACCGGAGTACCTGCTGAAGGTCAATGCTCGAGCATTGACCTTCAGCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004364
VALIDATED
ASAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004364.1-4399s1c1
Sequence:CCGGCGCATCTGTATCATCGGTCTTCTCGAGAAGACCGATGATACAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004364.1-720s1c1
Sequence:CCGGGCCCTTTGATAAAGCTTGGAACTCGAGTTCCAAGCTTTATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004364.1-1345s1c1
Sequence:CCGGGAAATTATGGAGTGTTGCCTACTCGAGTAGGCAACACTCCATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004364.1-1305s1c1
Sequence:CCGGCGGCACTCTTGCCAAGAATATCTCGAGATATTCTTGGCAAGAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004364.1-1783s1c1
Sequence:CCGGGCCTCCATTGAGATAGCCAATCTCGAGATTGGCTATCTCAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004364.2-3496s21c1
Sequence:GTACCGGCTTAGCCCAATTCCGACATTGCTCGAGCAATGTCGGAATTGGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-2336s21c1
Sequence:GTACCGGCCCATGTTCACGTCGAGTATGCTCGAGCATACTCGACGTGAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-1430s21c1
Sequence:GTACCGGACGAACAAGAATGTCAGATATCTCGAGATATCTGACATTCTTGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-1482s21c1
Sequence:GTACCGGAGCTCTGAACAACGCCTTTAACTCGAGTTAAAGGCGTTGTTCAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-887s21c1
Sequence:GTACCGGAGTACCTGCTGAAGGTCAATGCTCGAGCATTGACCTTCAGCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004364
VALIDATED
ASAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004364.1-4399s1c1
Sequence:CCGGCGCATCTGTATCATCGGTCTTCTCGAGAAGACCGATGATACAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004364.1-720s1c1
Sequence:CCGGGCCCTTTGATAAAGCTTGGAACTCGAGTTCCAAGCTTTATCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004364.1-1345s1c1
Sequence:CCGGGAAATTATGGAGTGTTGCCTACTCGAGTAGGCAACACTCCATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004364.1-1305s1c1
Sequence:CCGGCGGCACTCTTGCCAAGAATATCTCGAGATATTCTTGGCAAGAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004364.1-1783s1c1
Sequence:CCGGGCCTCCATTGAGATAGCCAATCTCGAGATTGGCTATCTCAATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004364.2-3496s21c1
Sequence:GTACCGGCTTAGCCCAATTCCGACATTGCTCGAGCAATGTCGGAATTGGGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-2336s21c1
Sequence:GTACCGGCCCATGTTCACGTCGAGTATGCTCGAGCATACTCGACGTGAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-1430s21c1
Sequence:GTACCGGACGAACAAGAATGTCAGATATCTCGAGATATCTGACATTCTTGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-1482s21c1
Sequence:GTACCGGAGCTCTGAACAACGCCTTTAACTCGAGTTAAAGGCGTTGTTCAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001004364.2-887s21c1
Sequence:GTACCGGAGTACCTGCTGAAGGTCAATGCTCGAGCATTGACCTTCAGCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003887
ASAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-1059s1c1
Sequence:CCGGGCCTCAAACCTTCCATTGAAACTCGAGTTTCAATGGAAGGTTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-715s1c1
Sequence:CCGGCCCTTTGGACAGTTTGCTGAACTCGAGTTCAGCAAACTGTCCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-3329s1c1
Sequence:CCGGCCGGTGTCATTTGTGCACTTTCTCGAGAAAGTGCACAAATGACACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-2179s1c1
Sequence:CCGGCCTGGATAAACAGACAGGGAACTCGAGTTCCCTGTCTGTTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1200s21c1
Sequence:GTACCGGTTCGTCAGAGCACAGCTTATACTCGAGTATAAGCTGTGCTCTGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-3181s21c1
Sequence:CCGGGCGGGTGAAAGCGCTCTATAACTCGAGTTATAGAGCGCTTTCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1135s21c1
Sequence:CCGGGTTGATACAGCTTCGAGATATCTCGAGATATCTCGAAGCTGTATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003887.2-3390s21c1
Sequence:CCGGTATGTTCCTGTTTCGTTATTGCTCGAGCAATAACGAAACAGGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-3329s21c1
Sequence:CCGGCCGGTGTCATTTGTGCACTTTCTCGAGAAAGTGCACAAATGACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1059s21c1
Sequence:CCGGGCCTCAAACCTTCCATTGAAACTCGAGTTTCAATGGAAGGTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-869s21c1
Sequence:GTACCGGGAAATAAGCGGAGCGGAAATTCTCGAGAATTTCCGCTCCGCTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003887.2-3637s21c1
Sequence:GTACCGGGATCCTGCCTCTACGGAATTACTCGAGTAATTCCGTAGAGGCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-924s21c1
Sequence:GTACCGGAGCTACAGATGTGCGAGTATCCTCGAGGATACTCGCACATCTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003887
ASAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-1059s1c1
Sequence:CCGGGCCTCAAACCTTCCATTGAAACTCGAGTTTCAATGGAAGGTTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-715s1c1
Sequence:CCGGCCCTTTGGACAGTTTGCTGAACTCGAGTTCAGCAAACTGTCCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-3329s1c1
Sequence:CCGGCCGGTGTCATTTGTGCACTTTCTCGAGAAAGTGCACAAATGACACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-2179s1c1
Sequence:CCGGCCTGGATAAACAGACAGGGAACTCGAGTTCCCTGTCTGTTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1200s21c1
Sequence:GTACCGGTTCGTCAGAGCACAGCTTATACTCGAGTATAAGCTGTGCTCTGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-3181s21c1
Sequence:CCGGGCGGGTGAAAGCGCTCTATAACTCGAGTTATAGAGCGCTTTCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1135s21c1
Sequence:CCGGGTTGATACAGCTTCGAGATATCTCGAGATATCTCGAAGCTGTATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003887.2-3390s21c1
Sequence:CCGGTATGTTCCTGTTTCGTTATTGCTCGAGCAATAACGAAACAGGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-3329s21c1
Sequence:CCGGCCGGTGTCATTTGTGCACTTTCTCGAGAAAGTGCACAAATGACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1059s21c1
Sequence:CCGGGCCTCAAACCTTCCATTGAAACTCGAGTTTCAATGGAAGGTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-869s21c1
Sequence:GTACCGGGAAATAAGCGGAGCGGAAATTCTCGAGAATTTCCGCTCCGCTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003887.2-3637s21c1
Sequence:GTACCGGGATCCTGCCTCTACGGAATTACTCGAGTAATTCCGTAGAGGCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-924s21c1
Sequence:GTACCGGAGCTACAGATGTGCGAGTATCCTCGAGGATACTCGCACATCTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003887
ASAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-1059s1c1
Sequence:CCGGGCCTCAAACCTTCCATTGAAACTCGAGTTTCAATGGAAGGTTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-715s1c1
Sequence:CCGGCCCTTTGGACAGTTTGCTGAACTCGAGTTCAGCAAACTGTCCAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-3329s1c1
Sequence:CCGGCCGGTGTCATTTGTGCACTTTCTCGAGAAAGTGCACAAATGACACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003887.1-2179s1c1
Sequence:CCGGCCTGGATAAACAGACAGGGAACTCGAGTTCCCTGTCTGTTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1200s21c1
Sequence:GTACCGGTTCGTCAGAGCACAGCTTATACTCGAGTATAAGCTGTGCTCTGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-3181s21c1
Sequence:CCGGGCGGGTGAAAGCGCTCTATAACTCGAGTTATAGAGCGCTTTCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1135s21c1
Sequence:CCGGGTTGATACAGCTTCGAGATATCTCGAGATATCTCGAAGCTGTATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003887.2-3390s21c1
Sequence:CCGGTATGTTCCTGTTTCGTTATTGCTCGAGCAATAACGAAACAGGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-3329s21c1
Sequence:CCGGCCGGTGTCATTTGTGCACTTTCTCGAGAAAGTGCACAAATGACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-1059s21c1
Sequence:CCGGGCCTCAAACCTTCCATTGAAACTCGAGTTTCAATGGAAGGTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-869s21c1
Sequence:GTACCGGGAAATAAGCGGAGCGGAAATTCTCGAGAATTTCCGCTCCGCTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003887.2-3637s21c1
Sequence:GTACCGGGATCCTGCCTCTACGGAATTACTCGAGTAATTCCGTAGAGGCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003887.2-924s21c1
Sequence:GTACCGGAGCTACAGATGTGCGAGTATCCTCGAGGATACTCGCACATCTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks