EMAIL THIS PAGE TO A FRIEND

ASAP3

ArfGAP with SH3 domain, ankyrin repeat and PH domain 3

97 Gene Product Result for
Synonyms: ACAP4 CENTB6 DDEFL1 UPLC1
UniProtKB ID: Q8TDY4, B3KRW0, B4DHH4, Q6P9F4, Q86UY1, Q9NXK2
Gene ID:
Human(55616) Summary: This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Mouse(230837) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Zebrafish(664764) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Horse(100071599) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
cow(523797) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
domestic cat(101095995) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
dog(487377) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
naked mole-rat(101710691) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
domestic guinea pig(100714955) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
sheep(101120897) ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017707 Rosetta Predictions human pricing
NM_001008232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159773 predicted 1587
2 SASI_Hs01_00159776 predicted 2577
3 SASI_Hs01_00159777 predicted 1641
4 SASI_Hs01_00159778 predicted 1791
5 SASI_Hs01_00159779 predicted 1035
6 SASI_Hs02_00350467 predicted 888
7 SASI_Hs01_00159780 predicted 2224
8 SASI_Hs01_00159781 predicted 1545
9 SASI_Hs01_00159782 predicted 1317
10 SASI_Hs02_00350468 predicted 1535
11 SASI_Hs01_00159774 predicted 781
12 SASI_Hs01_00159775 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024472 predicted 508
2 SASI_Mm01_00024473 predicted 247
3 SASI_Mm01_00024474 predicted 1644
4 SASI_Mm02_00286772 predicted 2897
5 SASI_Mm01_00024475 predicted 1677
6 SASI_Mm01_00024476 predicted 271
7 SASI_Mm01_00024477 predicted 1374
8 SASI_Mm01_00024478 predicted 1698
9 SASI_Mm01_00024480 predicted 570
10 SASI_Mm01_00024481 predicted 1218
11 SASI_Mm01_00024479 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017707
VALIDATED
ASAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1770s21c1
Sequence:CCGGAGCGACTCTGGACAGCCATTTCTCGAGAAATGGCTGTCCAGAGTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-2305s21c1
Sequence:CCGGCATCAGCAACAAGACCTATGACTCGAGTCATAGGTCTTGTTGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1092s21c1
Sequence:CCGGGGAAGTGTGGAGTCAAGTATGCTCGAGCATACTTGACTCCACACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017707.3-3138s21c1
Sequence:CCGGATCAGATCGAGACTCTATTTCCTCGAGGAAATAGAGTCTCGATCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1123s21c1
Sequence:CCGGCATCTCACACAGCACGATAAACTCGAGTTTATCGTGCTGTGTGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017707.3-3027s21c1
Sequence:CCGGAGGACTGATGGCGGTTCTTTCCTCGAGGAAAGAACCGCCATCAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-1981s1c1
Sequence:CCGGGCTTTGGTTGGCACAGTAAATCTCGAGATTTACTGTGCCAACCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-2725s1c1
Sequence:CCGGCCAGCAAGTTCTGTGCAACTTCTCGAGAAGTTGCACAGAACTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-339s1c1
Sequence:CCGGCTTCCTAAACTTGGCCGTGTTCTCGAGAACACGGCCAAGTTTAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017707.2-1630s1c1
Sequence:CCGGGACTACATTATGGCCAAGTATCTCGAGATACTTGGCCATAATGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017707
VALIDATED
ASAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1770s21c1
Sequence:CCGGAGCGACTCTGGACAGCCATTTCTCGAGAAATGGCTGTCCAGAGTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-2305s21c1
Sequence:CCGGCATCAGCAACAAGACCTATGACTCGAGTCATAGGTCTTGTTGCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1092s21c1
Sequence:CCGGGGAAGTGTGGAGTCAAGTATGCTCGAGCATACTTGACTCCACACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017707.3-3138s21c1
Sequence:CCGGATCAGATCGAGACTCTATTTCCTCGAGGAAATAGAGTCTCGATCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1123s21c1
Sequence:CCGGCATCTCACACAGCACGATAAACTCGAGTTTATCGTGCTGTGTGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017707.3-3027s21c1
Sequence:CCGGAGGACTGATGGCGGTTCTTTCCTCGAGGAAAGAACCGCCATCAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-1981s1c1
Sequence:CCGGGCTTTGGTTGGCACAGTAAATCTCGAGATTTACTGTGCCAACCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-2725s1c1
Sequence:CCGGCCAGCAAGTTCTGTGCAACTTCTCGAGAAGTTGCACAGAACTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-339s1c1
Sequence:CCGGCTTCCTAAACTTGGCCGTGTTCTCGAGAACACGGCCAAGTTTAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017707.2-1630s1c1
Sequence:CCGGGACTACATTATGGCCAAGTATCTCGAGATACTTGGCCATAATGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017707
VALIDATED
ASAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1770s21c1
Sequence:CCGGAGCGACTCTGGACAGCCATTTCTCGAGAAATGGCTGTCCAGAGTCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-2305s21c1
Sequence:CCGGCATCAGCAACAAGACCTATGACTCGAGTCATAGGTCTTGTTGCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1092s21c1
Sequence:CCGGGGAAGTGTGGAGTCAAGTATGCTCGAGCATACTTGACTCCACACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017707.3-3138s21c1
Sequence:CCGGATCAGATCGAGACTCTATTTCCTCGAGGAAATAGAGTCTCGATCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017707.3-1123s21c1
Sequence:CCGGCATCTCACACAGCACGATAAACTCGAGTTTATCGTGCTGTGTGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017707.3-3027s21c1
Sequence:CCGGAGGACTGATGGCGGTTCTTTCCTCGAGGAAAGAACCGCCATCAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-1981s1c1
Sequence:CCGGGCTTTGGTTGGCACAGTAAATCTCGAGATTTACTGTGCCAACCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-2725s1c1
Sequence:CCGGCCAGCAAGTTCTGTGCAACTTCTCGAGAAGTTGCACAGAACTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017707.2-339s1c1
Sequence:CCGGCTTCCTAAACTTGGCCGTGTTCTCGAGAACACGGCCAAGTTTAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017707.2-1630s1c1
Sequence:CCGGGACTACATTATGGCCAAGTATCTCGAGATACTTGGCCATAATGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008232
ASAP3 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008232.1-3474s1c1
Sequence:CCGGCCTGCCTTGATTTCACAGAAACTCGAGTTTCTGTGAAATCAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-2726s1c1
Sequence:CCGGTCTGTGTAGTAGAAGGCACATCTCGAGATGTGCCTTCTACTACACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-1589s1c1
Sequence:CCGGGAACATCGGAAACTCCCACTTCTCGAGAAGTGGGAGTTTCCGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-464s1c1
Sequence:CCGGCCTGAACAACATCGTCTCCTTCTCGAGAAGGAGACGATGTTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-1580s1c1
Sequence:CCGGGCTGGCTTTGAACATCGGAAACTCGAGTTTCCGATGTTCAAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008232
ASAP3 MISSION shRNA shRNA Plasmid DNA
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008232.1-3474s1c1
Sequence:CCGGCCTGCCTTGATTTCACAGAAACTCGAGTTTCTGTGAAATCAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-2726s1c1
Sequence:CCGGTCTGTGTAGTAGAAGGCACATCTCGAGATGTGCCTTCTACTACACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-1589s1c1
Sequence:CCGGGAACATCGGAAACTCCCACTTCTCGAGAAGTGGGAGTTTCCGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-464s1c1
Sequence:CCGGCCTGAACAACATCGTCTCCTTCTCGAGAAGGAGACGATGTTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-1580s1c1
Sequence:CCGGGCTGGCTTTGAACATCGGAAACTCGAGTTTCCGATGTTCAAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008232
ASAP3 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with SH3 domain, ankyrin repeat and PH domain 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008232.1-3474s1c1
Sequence:CCGGCCTGCCTTGATTTCACAGAAACTCGAGTTTCTGTGAAATCAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-2726s1c1
Sequence:CCGGTCTGTGTAGTAGAAGGCACATCTCGAGATGTGCCTTCTACTACACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-1589s1c1
Sequence:CCGGGAACATCGGAAACTCCCACTTCTCGAGAAGTGGGAGTTTCCGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-464s1c1
Sequence:CCGGCCTGAACAACATCGTCTCCTTCTCGAGAAGGAGACGATGTTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008232.1-1580s1c1
Sequence:CCGGGCTGGCTTTGAACATCGGAAACTCGAGTTTCCGATGTTCAAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)