EMAIL THIS PAGE TO A FRIEND

ASB10

ankyrin repeat and SOCS box containing 10

46 Gene Product Result for
Synonyms: GLC1F
UniProtKB ID: Q8WXI3, A0AVH0, Q6ZUL6
Gene ID:
Human(136371) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. The SOCS box serves to couple suppressor of cytokine signaling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2008]
Mouse(117590) ankyrin repeat and SOCS box-containing 10
Rat(499972) ankyrin repeat and SOCS box-containing 10
naked mole-rat(101705599) ankyrin repeat and SOCS box containing 10
domestic guinea pig(100718113) ankyrin repeat and SOCS box containing 10
sheep(101114103) ankyrin repeat and SOCS box containing 10
Zebrafish(559467) ankyrin repeat and SOCS box containing 10
cow(616286) ankyrin repeat and SOCS box containing 10
domestic cat(101098292) ankyrin repeat and SOCS box containing 10
dog(482804) ankyrin repeat and SOCS box containing 10
chicken(768438) ankyrin repeat and SOCS box containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026381 MISSION® esiRNA esiRNA targeting mouse Asb10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080871 Rosetta Predictions human pricing
NM_001109216 Rosetta Predictions rat pricing
NM_080444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190157 predicted 499
2 SASI_Hs01_00190158 predicted 571
3 SASI_Hs01_00190160 predicted 532
4 SASI_Hs01_00190162 predicted 504
5 SASI_Hs01_00190163 predicted 486
6 SASI_Hs01_00190164 predicted 549
7 SASI_Hs02_00362665 predicted 974
8 SASI_Hs01_00190165 predicted 853
9 SASI_Hs02_00362666 predicted 1018
10 SASI_Hs01_00190166 predicted 1174
11 SASI_Hs01_00190159 predicted 577
12 SASI_Hs01_00190161 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246230 predicted 1298
2 SASI_Rn02_00246231 predicted 1308
3 SASI_Rn02_00246232 predicted 1448
4 SASI_Rn02_00246233 predicted 1488
5 SASI_Rn02_00246234 predicted 1237
6 SASI_Rn02_00246235 predicted 1014
7 SASI_Rn02_00246236 predicted 1144
8 SASI_Rn02_00246237 predicted 210
9 SASI_Rn02_00246238 predicted 794
10 SASI_Rn02_00246239 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116860 predicted 1481
2 SASI_Mm01_00116861 predicted 858
3 SASI_Mm01_00116862 predicted 1295
4 SASI_Mm01_00116863 predicted 385
5 SASI_Mm01_00116864 predicted 1291
6 SASI_Mm02_00338101 predicted 1497
7 SASI_Mm01_00116865 predicted 782
8 SASI_Mm01_00116866 predicted 1040
9 SASI_Mm02_00338102 predicted 1160
10 SASI_Mm01_00116867 predicted 338
11 SASI_Mm01_00116868 predicted 387
12 SASI_Mm01_00116869 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080871
ASB10 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-381s21c1
Sequence:CCGGGGACTCTGGTCTCTGACATACCTCGAGGTATGTCAGAGACCAGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-1449s21c1
Sequence:CCGGTTTGAGGGCGTGCTCTACTAGCTCGAGCTAGTAGAGCACGCCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-1209s21c1
Sequence:CCGGGTCCTGATGAACACCTACAGTCTCGAGACTGTAGGTGTTCATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-233s21c1
Sequence:CCGGACCACTGCTCTGCCAAGACATCTCGAGATGTCTTGGCAGAGCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080871.2-1665s1c1
Sequence:CCGGGCAGGTGTGGATGCTGCAATTCTCGAGAATTGCAGCATCCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-506s1c1
Sequence:CCGGCTCCTGATTCCGTCTTTGATACTCGAGTATCAAAGACGGAATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-1361s1c1
Sequence:CCGGCCAAGAAACATCAGCGTTTCTCTCGAGAGAAACGCTGATGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-976s1c1
Sequence:CCGGGCATGTCCTGATGCCCGCAATCTCGAGATTGCGGGCATCAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-576s1c1
Sequence:CCGGGAGACTCTGGTCTCTGACATACTCGAGTATGTCAGAGACCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080871
ASB10 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-381s21c1
Sequence:CCGGGGACTCTGGTCTCTGACATACCTCGAGGTATGTCAGAGACCAGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-1449s21c1
Sequence:CCGGTTTGAGGGCGTGCTCTACTAGCTCGAGCTAGTAGAGCACGCCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-1209s21c1
Sequence:CCGGGTCCTGATGAACACCTACAGTCTCGAGACTGTAGGTGTTCATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-233s21c1
Sequence:CCGGACCACTGCTCTGCCAAGACATCTCGAGATGTCTTGGCAGAGCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080871.2-1665s1c1
Sequence:CCGGGCAGGTGTGGATGCTGCAATTCTCGAGAATTGCAGCATCCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-506s1c1
Sequence:CCGGCTCCTGATTCCGTCTTTGATACTCGAGTATCAAAGACGGAATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-1361s1c1
Sequence:CCGGCCAAGAAACATCAGCGTTTCTCTCGAGAGAAACGCTGATGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-976s1c1
Sequence:CCGGGCATGTCCTGATGCCCGCAATCTCGAGATTGCGGGCATCAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-576s1c1
Sequence:CCGGGAGACTCTGGTCTCTGACATACTCGAGTATGTCAGAGACCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080871
ASB10 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-381s21c1
Sequence:CCGGGGACTCTGGTCTCTGACATACCTCGAGGTATGTCAGAGACCAGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-1449s21c1
Sequence:CCGGTTTGAGGGCGTGCTCTACTAGCTCGAGCTAGTAGAGCACGCCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-1209s21c1
Sequence:CCGGGTCCTGATGAACACCTACAGTCTCGAGACTGTAGGTGTTCATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080871.3-233s21c1
Sequence:CCGGACCACTGCTCTGCCAAGACATCTCGAGATGTCTTGGCAGAGCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118397    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080871.2-1665s1c1
Sequence:CCGGGCAGGTGTGGATGCTGCAATTCTCGAGAATTGCAGCATCCACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-506s1c1
Sequence:CCGGCTCCTGATTCCGTCTTTGATACTCGAGTATCAAAGACGGAATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-1361s1c1
Sequence:CCGGCCAAGAAACATCAGCGTTTCTCTCGAGAGAAACGCTGATGTTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-976s1c1
Sequence:CCGGGCATGTCCTGATGCCCGCAATCTCGAGATTGCGGGCATCAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080871.2-576s1c1
Sequence:CCGGGAGACTCTGGTCTCTGACATACTCGAGTATGTCAGAGACCAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080444
ASB10 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 10
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080444.4-1715s21c1
Sequence:CCGGGAGCAATGGTGCAGGTGTTAGCTCGAGCTAACACCTGCACCATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080444.4-415s21c1
Sequence:CCGGAGACTCTGGTCTCTGACATATCTCGAGATATGTCAGAGACCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080444.2-2000s1c1
Sequence:CCGGCCTCACATGCAGTGGTTAATACTCGAGTATTAACCACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-1299s1c1
Sequence:CCGGGCCACCAGAGATTCTACAGAACTCGAGTTCTGTAGAATCTCTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-1245s1c1
Sequence:CCGGCCTGATGAATACATACCGTGTCTCGAGACACGGTATGTATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-815s1c1
Sequence:CCGGCGTGTCCTGATGTCCGCAATTCTCGAGAATTGCGGACATCAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-393s1c1
Sequence:CCGGCCGCTTCAACATCCGTGCTTTCTCGAGAAAGCACGGATGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080444
ASB10 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 10
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080444.4-1715s21c1
Sequence:CCGGGAGCAATGGTGCAGGTGTTAGCTCGAGCTAACACCTGCACCATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080444.4-415s21c1
Sequence:CCGGAGACTCTGGTCTCTGACATATCTCGAGATATGTCAGAGACCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080444.2-2000s1c1
Sequence:CCGGCCTCACATGCAGTGGTTAATACTCGAGTATTAACCACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-1299s1c1
Sequence:CCGGGCCACCAGAGATTCTACAGAACTCGAGTTCTGTAGAATCTCTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-1245s1c1
Sequence:CCGGCCTGATGAATACATACCGTGTCTCGAGACACGGTATGTATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-815s1c1
Sequence:CCGGCGTGTCCTGATGTCCGCAATTCTCGAGAATTGCGGACATCAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-393s1c1
Sequence:CCGGCCGCTTCAACATCCGTGCTTTCTCGAGAAAGCACGGATGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080444
ASB10 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 10
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080444.4-1715s21c1
Sequence:CCGGGAGCAATGGTGCAGGTGTTAGCTCGAGCTAACACCTGCACCATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080444.4-415s21c1
Sequence:CCGGAGACTCTGGTCTCTGACATATCTCGAGATATGTCAGAGACCAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080444.2-2000s1c1
Sequence:CCGGCCTCACATGCAGTGGTTAATACTCGAGTATTAACCACTGCATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-1299s1c1
Sequence:CCGGGCCACCAGAGATTCTACAGAACTCGAGTTCTGTAGAATCTCTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-1245s1c1
Sequence:CCGGCCTGATGAATACATACCGTGTCTCGAGACACGGTATGTATTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-815s1c1
Sequence:CCGGCGTGTCCTGATGTCCGCAATTCTCGAGAATTGCGGACATCAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080444.2-393s1c1
Sequence:CCGGCCGCTTCAACATCCGTGCTTTCTCGAGAAAGCACGGATGTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks