EMAIL THIS PAGE TO A FRIEND

ASB11

ankyrin repeat and SOCS box containing 11

UniProtKB ID: Q8WXH4, E9PEN1, Q3SYC4, Q7Z667
Gene ID:
Human(140456) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(68854) ankyrin repeat and SOCS box-containing 11
Rat(302666) ankyrin repeat and SOCS box-containing 11
Zebrafish(791758) ankyrin repeat and SOCS box-containing 11
chicken(428004) ankyrin repeat and SOCS box containing 11
chicken(101749218) ankyrin repeat and SOCS box containing 11
chicken(101669124) ankyrin repeat and SOCS box containing 11
cow(511852) ankyrin repeat and SOCS box containing 11
Horse(100050799) ankyrin repeat and SOCS box containing 11
domestic cat(101094483) ankyrin repeat and SOCS box containing 11
dog(612782) ankyrin repeat and SOCS box containing 11
sheep(101101864) ankyrin repeat and SOCS box containing 11
domestic guinea pig(100713888) ankyrin repeat and SOCS box containing 11
naked mole-rat(101724054) ankyrin repeat and SOCS box containing 11
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080873 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070681 MISSION® esiRNA esiRNA human ASB11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012428 Rosetta Predictions human pricing
NM_080873 Rosetta Predictions human pricing
NM_001106962 Rosetta Predictions rat pricing
NM_026853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306146 predicted 625
2 SASI_Hs01_00102977 predicted 746
3 SASI_Hs02_00306147 predicted 486
4 SASI_Hs01_00102978 predicted 517
5 SASI_Hs01_00102979 predicted 743
6 SASI_Hs01_00102980 predicted 533
7 SASI_Hs01_00102981 predicted 746
8 SASI_Hs01_00102982 predicted 737
9 SASI_Hs01_00102983 predicted 503
10 SASI_Hs01_00102984 predicted 702
11 SASI_Hs01_00102985 predicted 532
12 SASI_Hs01_00102986 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362669 predicted 622
2 SASI_Hs01_00107923 predicted 742
3 SASI_Hs02_00362670 predicted 493
4 SASI_Hs01_00107924 predicted 518
5 SASI_Hs01_00107925 predicted 744
6 SASI_Hs01_00107926 predicted 536
7 SASI_Hs01_00107927 predicted 742
8 SASI_Hs01_00107928 predicted 735
9 SASI_Hs01_00107929 predicted 503
10 SASI_Hs01_00107930 predicted 707
11 SASI_Hs01_00107931 predicted 533
12 SASI_Hs01_00107932 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224126 predicted 272
2 SASI_Rn02_00224127 predicted 951
3 SASI_Rn02_00224128 predicted 935
4 SASI_Rn02_00224129 predicted 473
5 SASI_Rn02_00224130 predicted 481
6 SASI_Rn02_00224131 predicted 531
7 SASI_Rn02_00224132 predicted 981
8 SASI_Rn02_00224133 predicted 202
9 SASI_Rn02_00224134 predicted 890
10 SASI_Rn02_00224135 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174270 predicted 901
2 SASI_Mm01_00174271 predicted 272
3 SASI_Mm01_00174272 predicted 561
4 SASI_Mm01_00174273 predicted 484
5 SASI_Mm01_00174274 predicted 982
6 SASI_Mm01_00174275 predicted 1035
7 SASI_Mm01_00174276 predicted 534
8 SASI_Mm01_00174277 predicted 894
9 SASI_Mm01_00174278 predicted 191
10 SASI_Mm01_00174279 predicted 697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080873
ASB11 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-426s1c1
Sequence:CCGGCAGTGCTGCATGTGTCAATGTCTCGAGACATTGACACATGCAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-628s1c1
Sequence:CCGGGACTGTGTGAAGAAACTTCTACTCGAGTAGAAGTTTCTTCACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-546s1c1
Sequence:CCGGGCTGGCAAATAATGTTAACATCTCGAGATGTTAACATTATTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-766s1c1
Sequence:CCGGCGTAGAAATGCTCAGGGCAAACTCGAGTTTGCCCTGAGCATTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-632s1c1
Sequence:CCGGGTGTGAAGAAACTTCTAGAATCTCGAGATTCTAGAAGTTTCTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-543s1c1
Sequence:CCGGCCTGCTGGCAAATAATGTTAACTCGAGTTAACATTATTTGCCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-538s1c1
Sequence:CCGGGAGATCCTGCTGGCAAATAATCTCGAGATTATTTGCCAGCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-744s1c1
Sequence:CCGGCGACTATGGAGCTAACCTGAACTCGAGTTCAGGTTAGCTCCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-333s21c1
Sequence:CCGGGGCCTGTGCCAAAGCCTTATTCTCGAGAATAAGGCTTTGGCACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-149s21c1
Sequence:CCGGGGATAGCAGAAGAGATCTATGCTCGAGCATAGATCTCTTCTGCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-270s21c1
Sequence:CCGGTGTGAACCTTGTGACAATTAACTCGAGTTAATTGTCACAAGGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080873
ASB11 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-426s1c1
Sequence:CCGGCAGTGCTGCATGTGTCAATGTCTCGAGACATTGACACATGCAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-628s1c1
Sequence:CCGGGACTGTGTGAAGAAACTTCTACTCGAGTAGAAGTTTCTTCACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-546s1c1
Sequence:CCGGGCTGGCAAATAATGTTAACATCTCGAGATGTTAACATTATTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-766s1c1
Sequence:CCGGCGTAGAAATGCTCAGGGCAAACTCGAGTTTGCCCTGAGCATTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-632s1c1
Sequence:CCGGGTGTGAAGAAACTTCTAGAATCTCGAGATTCTAGAAGTTTCTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-543s1c1
Sequence:CCGGCCTGCTGGCAAATAATGTTAACTCGAGTTAACATTATTTGCCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-538s1c1
Sequence:CCGGGAGATCCTGCTGGCAAATAATCTCGAGATTATTTGCCAGCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-744s1c1
Sequence:CCGGCGACTATGGAGCTAACCTGAACTCGAGTTCAGGTTAGCTCCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-333s21c1
Sequence:CCGGGGCCTGTGCCAAAGCCTTATTCTCGAGAATAAGGCTTTGGCACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-149s21c1
Sequence:CCGGGGATAGCAGAAGAGATCTATGCTCGAGCATAGATCTCTTCTGCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-270s21c1
Sequence:CCGGTGTGAACCTTGTGACAATTAACTCGAGTTAATTGTCACAAGGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080873
ASB11 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-426s1c1
Sequence:CCGGCAGTGCTGCATGTGTCAATGTCTCGAGACATTGACACATGCAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-628s1c1
Sequence:CCGGGACTGTGTGAAGAAACTTCTACTCGAGTAGAAGTTTCTTCACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-546s1c1
Sequence:CCGGGCTGGCAAATAATGTTAACATCTCGAGATGTTAACATTATTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-766s1c1
Sequence:CCGGCGTAGAAATGCTCAGGGCAAACTCGAGTTTGCCCTGAGCATTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-632s1c1
Sequence:CCGGGTGTGAAGAAACTTCTAGAATCTCGAGATTCTAGAAGTTTCTTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-543s1c1
Sequence:CCGGCCTGCTGGCAAATAATGTTAACTCGAGTTAACATTATTTGCCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-538s1c1
Sequence:CCGGGAGATCCTGCTGGCAAATAATCTCGAGATTATTTGCCAGCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080873.1-744s1c1
Sequence:CCGGCGACTATGGAGCTAACCTGAACTCGAGTTCAGGTTAGCTCCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-333s21c1
Sequence:CCGGGGCCTGTGCCAAAGCCTTATTCTCGAGAATAAGGCTTTGGCACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-149s21c1
Sequence:CCGGGGATAGCAGAAGAGATCTATGCTCGAGCATAGATCTCTTCTGCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080873.1-270s21c1
Sequence:CCGGTGTGAACCTTGTGACAATTAACTCGAGTTAATTGTCACAAGGTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026853
ASB11 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026853.1-1023s1c1
Sequence:CCGGCCAGACACTTGTGCTGAACAACTCGAGTTGTTCAGCACAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-197s1c1
Sequence:CCGGCAAGGCATCAACGTCAATCTTCTCGAGAAGATTGACGTTGATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-497s1c1
Sequence:CCGGGTTAACATTGAGCAAGAGGTTCTCGAGAACCTCTTGCTCAATGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026853.1-62s1c1
Sequence:CCGGCCTGGACCATGGAAAGAGATTCTCGAGAATCTCTTTCCATGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-196s1c1
Sequence:CCGGGCAAGGCATCAACGTCAATCTCTCGAGAGATTGACGTTGATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-559s1c1
Sequence:CCGGGAGAGTTGATTGTGTGAAGAACTCGAGTTCTTCACACAATCAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026853.1-989s1c1
Sequence:CCGGCTACTCACCCAATTAGAATAACTCGAGTTATTCTAATTGGGTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026853
ASB11 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026853.1-1023s1c1
Sequence:CCGGCCAGACACTTGTGCTGAACAACTCGAGTTGTTCAGCACAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-197s1c1
Sequence:CCGGCAAGGCATCAACGTCAATCTTCTCGAGAAGATTGACGTTGATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-497s1c1
Sequence:CCGGGTTAACATTGAGCAAGAGGTTCTCGAGAACCTCTTGCTCAATGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026853.1-62s1c1
Sequence:CCGGCCTGGACCATGGAAAGAGATTCTCGAGAATCTCTTTCCATGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-196s1c1
Sequence:CCGGGCAAGGCATCAACGTCAATCTCTCGAGAGATTGACGTTGATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-559s1c1
Sequence:CCGGGAGAGTTGATTGTGTGAAGAACTCGAGTTCTTCACACAATCAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026853.1-989s1c1
Sequence:CCGGCTACTCACCCAATTAGAATAACTCGAGTTATTCTAATTGGGTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026853
ASB11 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026853.1-1023s1c1
Sequence:CCGGCCAGACACTTGTGCTGAACAACTCGAGTTGTTCAGCACAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-197s1c1
Sequence:CCGGCAAGGCATCAACGTCAATCTTCTCGAGAAGATTGACGTTGATGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-497s1c1
Sequence:CCGGGTTAACATTGAGCAAGAGGTTCTCGAGAACCTCTTGCTCAATGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026853.1-62s1c1
Sequence:CCGGCCTGGACCATGGAAAGAGATTCTCGAGAATCTCTTTCCATGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-196s1c1
Sequence:CCGGGCAAGGCATCAACGTCAATCTCTCGAGAGATTGACGTTGATGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026853.1-559s1c1
Sequence:CCGGGAGAGTTGATTGTGTGAAGAACTCGAGTTCTTCACACAATCAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026853.1-989s1c1
Sequence:CCGGCTACTCACCCAATTAGAATAACTCGAGTTATTCTAATTGGGTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks