EMAIL THIS PAGE TO A FRIEND

ASB12

ankyrin repeat and SOCS box containing 12

50 Gene Product Result for
UniProtKB ID: Q8WXK4, J3KP57, Q2M3D5, Q52LK4, Q6ISF9, Q8N8F5
Gene ID:
Human(142689) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Jan 2011]
Mouse(70392) ankyrin repeat and SOCS box-containing 12
Rat(503446) ankyrin repeat and SOCS box-containing 12
naked mole-rat(101717325) ankyrin repeat and SOCS box containing 12
domestic guinea pig(100732444) ankyrin repeat and SOCS box containing 12
sheep(101111073) ankyrin repeat and SOCS box containing 12
chicken(422313) ankyrin repeat and SOCS box containing 12
dog(480939) ankyrin repeat and SOCS box containing 12
domestic cat(101099618) ankyrin repeat and SOCS box containing 12
cow(539344) ankyrin repeat and SOCS box containing 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100161 Anti-ASB12 antibody produced in rabbit affinity isolated antibody rat, human, canine, mouse, guinea pig, horse, rabbit
western blot pricing
SAB2700664 Anti-ASB12 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130388 Rosetta Predictions human pricing
NM_001037367 Rosetta Predictions rat pricing
NM_080858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093048 predicted 646
2 SASI_Hs01_00093049 predicted 608
3 SASI_Hs02_00362710 predicted 547
4 SASI_Hs01_00093050 predicted 740
5 SASI_Hs01_00093051 predicted 766
6 SASI_Hs01_00093052 predicted 530
7 SASI_Hs01_00093053 predicted 466
8 SASI_Hs01_00093054 predicted 795
9 SASI_Hs01_00093055 predicted 616
10 SASI_Hs01_00093056 predicted 263
11 SASI_Hs01_00093057 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070461 predicted 474
2 SASI_Rn01_00070462 predicted 509
3 SASI_Rn01_00070463 predicted 919
4 SASI_Rn01_00070464 predicted 790
5 SASI_Rn01_00070466 predicted 643
6 SASI_Rn01_00070467 predicted 981
7 SASI_Rn01_00070468 predicted 391
8 SASI_Rn02_00204422 predicted 757
9 SASI_Rn02_00204423 predicted 531
10 SASI_Rn01_00070469 predicted 1042
11 SASI_Rn01_00070460 predicted 412
12 SASI_Rn01_00070465 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338239 predicted 343
2 SASI_Mm01_00023890 predicted 732
3 SASI_Mm01_00023891 predicted 846
4 SASI_Mm01_00023892 predicted 403
5 SASI_Mm01_00023893 predicted 408
6 SASI_Mm01_00023894 predicted 279
7 SASI_Mm01_00023895 predicted 653
8 SASI_Mm01_00023896 predicted 327
9 SASI_Mm01_00023897 predicted 463
10 SASI_Mm01_00023898 predicted 1020
11 SASI_Mm01_00023889 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130388
ASB12 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 12
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-690s21c1
Sequence:CCGGTATCCAGCTGTTAATCGATTTCTCGAGAAATCGATTAACAGCTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-202s21c1
Sequence:CCGGTTGCGCTTGGCTGCTTCTTATCTCGAGATAAGAAGCAGCCAAGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-101s21c1
Sequence:CCGGTGTATGACAACGACTCCTATACTCGAGTATAGGAGTCGTTGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-655s21c1
Sequence:CCGGGAAATCTGCCTCCATCATAATCTCGAGATTATGATGGAGGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-466s1c1
Sequence:CCGGGCCAACGTCAAAGCTAAACTACTCGAGTAGTTTAGCTTTGACGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-479s1c1
Sequence:CCGGCTAAACTACCAGTCTGGGCATCTCGAGATGCCCAGACTGGTAGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-463s1c1
Sequence:CCGGGAGGCCAACGTCAAAGCTAAACTCGAGTTTAGCTTTGACGTTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-141s1c1
Sequence:CCGGCCAGGAGCGTTACAAACGTTTCTCGAGAAACGTTTGTAACGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-895s1c1
Sequence:CCGGCCCATGTTGATTAGCTACCTACTCGAGTAGGTAGCTAATCAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-752s1c1
Sequence:CCGGCCTCACAAGATGATAAAGGCACTCGAGTGCCTTTATCATCTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-747s1c1
Sequence:CCGGCCTGACCTCACAAGATGATAACTCGAGTTATCATCTTGTGAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-147s1c1
Sequence:CCGGGCGTTACAAACGTTTCATCAACTCGAGTTGATGAAACGTTTGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130388
ASB12 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 12
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-690s21c1
Sequence:CCGGTATCCAGCTGTTAATCGATTTCTCGAGAAATCGATTAACAGCTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-202s21c1
Sequence:CCGGTTGCGCTTGGCTGCTTCTTATCTCGAGATAAGAAGCAGCCAAGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-101s21c1
Sequence:CCGGTGTATGACAACGACTCCTATACTCGAGTATAGGAGTCGTTGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-655s21c1
Sequence:CCGGGAAATCTGCCTCCATCATAATCTCGAGATTATGATGGAGGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-466s1c1
Sequence:CCGGGCCAACGTCAAAGCTAAACTACTCGAGTAGTTTAGCTTTGACGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-479s1c1
Sequence:CCGGCTAAACTACCAGTCTGGGCATCTCGAGATGCCCAGACTGGTAGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-463s1c1
Sequence:CCGGGAGGCCAACGTCAAAGCTAAACTCGAGTTTAGCTTTGACGTTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-141s1c1
Sequence:CCGGCCAGGAGCGTTACAAACGTTTCTCGAGAAACGTTTGTAACGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-895s1c1
Sequence:CCGGCCCATGTTGATTAGCTACCTACTCGAGTAGGTAGCTAATCAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-752s1c1
Sequence:CCGGCCTCACAAGATGATAAAGGCACTCGAGTGCCTTTATCATCTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-747s1c1
Sequence:CCGGCCTGACCTCACAAGATGATAACTCGAGTTATCATCTTGTGAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-147s1c1
Sequence:CCGGGCGTTACAAACGTTTCATCAACTCGAGTTGATGAAACGTTTGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130388
ASB12 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 12
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-690s21c1
Sequence:CCGGTATCCAGCTGTTAATCGATTTCTCGAGAAATCGATTAACAGCTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-202s21c1
Sequence:CCGGTTGCGCTTGGCTGCTTCTTATCTCGAGATAAGAAGCAGCCAAGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-101s21c1
Sequence:CCGGTGTATGACAACGACTCCTATACTCGAGTATAGGAGTCGTTGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130388.2-655s21c1
Sequence:CCGGGAAATCTGCCTCCATCATAATCTCGAGATTATGATGGAGGCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-466s1c1
Sequence:CCGGGCCAACGTCAAAGCTAAACTACTCGAGTAGTTTAGCTTTGACGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-479s1c1
Sequence:CCGGCTAAACTACCAGTCTGGGCATCTCGAGATGCCCAGACTGGTAGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-463s1c1
Sequence:CCGGGAGGCCAACGTCAAAGCTAAACTCGAGTTTAGCTTTGACGTTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-141s1c1
Sequence:CCGGCCAGGAGCGTTACAAACGTTTCTCGAGAAACGTTTGTAACGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-895s1c1
Sequence:CCGGCCCATGTTGATTAGCTACCTACTCGAGTAGGTAGCTAATCAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130388.2-752s1c1
Sequence:CCGGCCTCACAAGATGATAAAGGCACTCGAGTGCCTTTATCATCTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-747s1c1
Sequence:CCGGCCTGACCTCACAAGATGATAACTCGAGTTATCATCTTGTGAGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130388.2-147s1c1
Sequence:CCGGGCGTTACAAACGTTTCATCAACTCGAGTTGATGAAACGTTTGTAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080858
ASB12 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080858.3-449s1c1
Sequence:CCGGGAACATGGTGCTGATGTTGATCTCGAGATCAACATCAGCACCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-408s1c1
Sequence:CCGGGCAGCTTCTTATGGTCACTTACTCGAGTAAGTGACCATAAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-954s1c1
Sequence:CCGGCAAGATGATAAAGGCATCAAACTCGAGTTTGATGCCTTTATCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-472s1c1
Sequence:CCGGGCTTGGATGTCAAAGCACAAACTCGAGTTTGTGCTTTGACATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080858.1-660s1c1
Sequence:CCGGGAGGCTAATGTCAAAGCTAAACTCGAGTTTAGCTTTGACATTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-750s1c1
Sequence:CCGGCTTGATTGTTTCCGCCTGCTTCTCGAGAAGCAGGCGGAAACAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-1021s1c1
Sequence:CCGGCCCGTTTAGTTATCCGCAGATCTCGAGATCTGCGGATAACTAAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080858
ASB12 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080858.3-449s1c1
Sequence:CCGGGAACATGGTGCTGATGTTGATCTCGAGATCAACATCAGCACCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-408s1c1
Sequence:CCGGGCAGCTTCTTATGGTCACTTACTCGAGTAAGTGACCATAAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-954s1c1
Sequence:CCGGCAAGATGATAAAGGCATCAAACTCGAGTTTGATGCCTTTATCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-472s1c1
Sequence:CCGGGCTTGGATGTCAAAGCACAAACTCGAGTTTGTGCTTTGACATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080858.1-660s1c1
Sequence:CCGGGAGGCTAATGTCAAAGCTAAACTCGAGTTTAGCTTTGACATTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-750s1c1
Sequence:CCGGCTTGATTGTTTCCGCCTGCTTCTCGAGAAGCAGGCGGAAACAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-1021s1c1
Sequence:CCGGCCCGTTTAGTTATCCGCAGATCTCGAGATCTGCGGATAACTAAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080858
ASB12 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080858.3-449s1c1
Sequence:CCGGGAACATGGTGCTGATGTTGATCTCGAGATCAACATCAGCACCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-408s1c1
Sequence:CCGGGCAGCTTCTTATGGTCACTTACTCGAGTAAGTGACCATAAGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-954s1c1
Sequence:CCGGCAAGATGATAAAGGCATCAAACTCGAGTTTGATGCCTTTATCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-472s1c1
Sequence:CCGGGCTTGGATGTCAAAGCACAAACTCGAGTTTGTGCTTTGACATCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080858.1-660s1c1
Sequence:CCGGGAGGCTAATGTCAAAGCTAAACTCGAGTTTAGCTTTGACATTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-750s1c1
Sequence:CCGGCTTGATTGTTTCCGCCTGCTTCTCGAGAAGCAGGCGGAAACAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080858.1-1021s1c1
Sequence:CCGGCCCGTTTAGTTATCCGCAGATCTCGAGATCTGCGGATAACTAAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks