EMAIL THIS PAGE TO A FRIEND

ASB13

ankyrin repeat and SOCS box containing 13

85 Gene Product Result for
UniProtKB ID: Q8WXK3, A8K7Q6, D3DRR2, Q96EP7, Q9H8Z1
Gene ID:
Human(79754) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants, both protein-coding and not protein-coding, have been described for this gene. [provided by RefSeq, Nov 2010]
Mouse(142688) ankyrin repeat and SOCS box-containing 13
Rat(361268) ankyrin repeat and SOCS box-containing 13
chicken(416691) ankyrin repeat and SOCS box containing 13
dog(608587) ankyrin repeat and SOCS box containing 13
cow(533598) ankyrin repeat and SOCS box containing 13
domestic cat(101081228) ankyrin repeat and SOCS box containing 13
sheep(101105590) ankyrin repeat and SOCS box containing 13
domestic guinea pig(100717013) ankyrin repeat and SOCS box containing 13
naked mole-rat(101717779) ankyrin repeat and SOCS box containing 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024701 Rosetta Predictions human pricing
XM_001068810 Rosetta Predictions rat pricing
XM_341551 Rosetta Predictions rat pricing
NM_080857 Rosetta Predictions mouse pricing
NM_178283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357159 predicted 511
2 SASI_Hs01_00019922 predicted 663
3 SASI_Hs01_00019923 predicted 1227
4 SASI_Hs01_00019924 predicted 715
5 SASI_Hs01_00019925 predicted 1156
6 SASI_Hs01_00019926 predicted 500
7 SASI_Hs01_00019927 predicted 392
8 SASI_Hs01_00019928 predicted 947
9 SASI_Hs01_00019929 predicted 606
10 SASI_Hs01_00019930 predicted 843
11 SASI_Hs01_00019931 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325928 predicted 598
2 SASI_Rn02_00325929 predicted 749
3 SASI_Rn02_00325930 predicted 1188
4 SASI_Rn02_00325931 predicted 585
5 SASI_Rn02_00325932 predicted 1214
6 SASI_Rn02_00325933 predicted 201
7 SASI_Rn02_00325934 predicted 492
8 SASI_Rn02_00325935 predicted 712
9 SASI_Rn02_00325936 predicted 546
10 SASI_Rn02_00325937 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169746 predicted 400
2 SASI_Rn02_00393077 predicted 230
3 SASI_Rn02_00393078 predicted 381
4 SASI_Rn01_00169747 predicted 333
5 SASI_Rn01_00169748 predicted 330
6 SASI_Rn01_00169750 predicted 335
7 SASI_Rn01_00169751 predicted 198
8 SASI_Rn01_00169752 predicted 372
9 SASI_Rn01_00169753 predicted 395
10 SASI_Rn01_00169754 predicted 390
11 SASI_Rn01_00169749 predicted 395
12 SASI_Rn01_00169755 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338233 predicted 693
2 SASI_Mm02_00338234 predicted 1116
3 SASI_Mm01_00067646 predicted 548
4 SASI_Mm02_00338235 predicted 927
5 SASI_Mm02_00338236 predicted 1129
6 SASI_Mm01_00067647 predicted 530
7 SASI_Mm01_00067650 predicted 576
8 SASI_Mm02_00338237 predicted 1170
9 SASI_Mm01_00067655 predicted 987
10 SASI_Mm02_00338238 predicted 1005
11 SASI_Mm01_00067648 predicted 413
12 SASI_Mm01_00067649 predicted 875
13 SASI_Mm01_00067651 predicted 736
14 SASI_Mm01_00067652 predicted 540
15 SASI_Mm01_00067653 predicted 448
16 SASI_Mm01_00067654 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348728 predicted 692
2 SASI_Mm02_00348729 predicted 1117
3 SASI_Mm01_00063085 predicted 549
4 SASI_Mm02_00348730 predicted 923
5 SASI_Mm02_00348731 predicted 1134
6 SASI_Mm01_00063086 predicted 533
7 SASI_Mm01_00063089 predicted 569
8 SASI_Mm02_00348732 predicted 1163
9 SASI_Mm01_00063094 predicted 988
10 SASI_Mm02_00348733 predicted 1006
11 SASI_Mm01_00063087 predicted 413
12 SASI_Mm01_00063088 predicted 873
13 SASI_Mm01_00063090 predicted 743
14 SASI_Mm01_00063091 predicted 537
15 SASI_Mm01_00063092 predicted 446
16 SASI_Mm01_00063093 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024701
VALIDATED
ASB13 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-801s1c1
Sequence:CCGGGCTGGAGAAGATTGCCAAGTTCTCGAGAACTTGGCAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-597s1c1
Sequence:CCGGCAAGGTCAAGAATGTTGACCTCTCGAGAGGTCAACATTCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024701.2-1523s1c1
Sequence:CCGGCCCACAAGTAGCACTGAGTTTCTCGAGAAACTCAGTGCTACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-606s1c1
Sequence:CCGGGAATGTTGACCTCATCGAGATCTCGAGATCTCGATGAGGTCAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-618s1c1
Sequence:CCGGCATCGAGATGCTTATCGAGTTCTCGAGAACTCGATAAGCATCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024701
VALIDATED
ASB13 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-801s1c1
Sequence:CCGGGCTGGAGAAGATTGCCAAGTTCTCGAGAACTTGGCAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-597s1c1
Sequence:CCGGCAAGGTCAAGAATGTTGACCTCTCGAGAGGTCAACATTCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024701.2-1523s1c1
Sequence:CCGGCCCACAAGTAGCACTGAGTTTCTCGAGAAACTCAGTGCTACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-606s1c1
Sequence:CCGGGAATGTTGACCTCATCGAGATCTCGAGATCTCGATGAGGTCAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-618s1c1
Sequence:CCGGCATCGAGATGCTTATCGAGTTCTCGAGAACTCGATAAGCATCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024701
VALIDATED
ASB13 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-801s1c1
Sequence:CCGGGCTGGAGAAGATTGCCAAGTTCTCGAGAACTTGGCAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-597s1c1
Sequence:CCGGCAAGGTCAAGAATGTTGACCTCTCGAGAGGTCAACATTCTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024701.2-1523s1c1
Sequence:CCGGCCCACAAGTAGCACTGAGTTTCTCGAGAAACTCAGTGCTACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-606s1c1
Sequence:CCGGGAATGTTGACCTCATCGAGATCTCGAGATCTCGATGAGGTCAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024701.2-618s1c1
Sequence:CCGGCATCGAGATGCTTATCGAGTTCTCGAGAACTCGATAAGCATCTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080857
VALIDATED
ASB13 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080857.1-1140s1c1
Sequence:CCGGCCTGGAACAAATGTAGTCATTCTCGAGAATGACTACATTTGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080857.1-382s1c1
Sequence:CCGGGAAAGTCAACCCTCCTTTGTACTCGAGTACAAAGGAGGGTTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080857.1-865s1c1
Sequence:CCGGGCTCATCGACTACCTTTCCTACTCGAGTAGGAAAGGTAGTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080857.1-1590s1c1
Sequence:CCGGGCAGCTTACAATGGCCCATTACTCGAGTAATGGGCCATTGTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080857.1-620s1c1
Sequence:CCGGGCAGCCAAGGTAAAGAACGTTCTCGAGAACGTTCTTTACCTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-620s21c1
Sequence:CCGGGCAGCCAAGGTAAAGAACGTTCTCGAGAACGTTCTTTACCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080857.2-446s1c1
Sequence:CCGGGAATGCGTGAGGCTTCTTATTCTCGAGAATAAGAAGCCTCACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-865s21c1
Sequence:CCGGGCTCATCGACTACCTTTCCTACTCGAGTAGGAAAGGTAGTCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080857.2-1593s21c1
Sequence:CCGGGCAGCTTACAATGGCCCATTACTCGAGTAATGGGCCATTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-382s21c1
Sequence:CCGGGAAAGTCAACCCTCCTTTGTACTCGAGTACAAAGGAGGGTTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080857
VALIDATED
ASB13 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080857.1-1140s1c1
Sequence:CCGGCCTGGAACAAATGTAGTCATTCTCGAGAATGACTACATTTGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080857.1-382s1c1
Sequence:CCGGGAAAGTCAACCCTCCTTTGTACTCGAGTACAAAGGAGGGTTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080857.1-865s1c1
Sequence:CCGGGCTCATCGACTACCTTTCCTACTCGAGTAGGAAAGGTAGTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080857.1-1590s1c1
Sequence:CCGGGCAGCTTACAATGGCCCATTACTCGAGTAATGGGCCATTGTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080857.1-620s1c1
Sequence:CCGGGCAGCCAAGGTAAAGAACGTTCTCGAGAACGTTCTTTACCTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-620s21c1
Sequence:CCGGGCAGCCAAGGTAAAGAACGTTCTCGAGAACGTTCTTTACCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080857.2-446s1c1
Sequence:CCGGGAATGCGTGAGGCTTCTTATTCTCGAGAATAAGAAGCCTCACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-865s21c1
Sequence:CCGGGCTCATCGACTACCTTTCCTACTCGAGTAGGAAAGGTAGTCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080857.2-1593s21c1
Sequence:CCGGGCAGCTTACAATGGCCCATTACTCGAGTAATGGGCCATTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-382s21c1
Sequence:CCGGGAAAGTCAACCCTCCTTTGTACTCGAGTACAAAGGAGGGTTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080857
VALIDATED
ASB13 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080857.1-1140s1c1
Sequence:CCGGCCTGGAACAAATGTAGTCATTCTCGAGAATGACTACATTTGTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080857.1-382s1c1
Sequence:CCGGGAAAGTCAACCCTCCTTTGTACTCGAGTACAAAGGAGGGTTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080857.1-865s1c1
Sequence:CCGGGCTCATCGACTACCTTTCCTACTCGAGTAGGAAAGGTAGTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080857.1-1590s1c1
Sequence:CCGGGCAGCTTACAATGGCCCATTACTCGAGTAATGGGCCATTGTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080857.1-620s1c1
Sequence:CCGGGCAGCCAAGGTAAAGAACGTTCTCGAGAACGTTCTTTACCTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-620s21c1
Sequence:CCGGGCAGCCAAGGTAAAGAACGTTCTCGAGAACGTTCTTTACCTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080857.2-446s1c1
Sequence:CCGGGAATGCGTGAGGCTTCTTATTCTCGAGAATAAGAAGCCTCACGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-865s21c1
Sequence:CCGGGCTCATCGACTACCTTTCCTACTCGAGTAGGAAAGGTAGTCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080857.2-1593s21c1
Sequence:CCGGGCAGCTTACAATGGCCCATTACTCGAGTAATGGGCCATTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080857.2-382s21c1
Sequence:CCGGGAAAGTCAACCCTCCTTTGTACTCGAGTACAAAGGAGGGTTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks