EMAIL THIS PAGE TO A FRIEND

ASB14

ankyrin repeat and SOCS box containing 14

44 Gene Product Result for
UniProtKB ID: A6NK59, C9JX97, Q8WXK2, Q92816
Gene ID:
Human(142686) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2008]
Mouse(142687) ankyrin repeat and SOCS box-containing 14
Rat(680076) ankyrin repeat and SOCS box-containing 14
Zebrafish(100535284) ankyrin repeat and SOCS box containing 14
cow(509431) ankyrin repeat and SOCS box containing 14
Horse(100058612) ankyrin repeat and SOCS box containing 14
domestic cat(101097219) ankyrin repeat and SOCS box containing 14
dog(607136) ankyrin repeat and SOCS box containing 14
chicken(416003) ankyrin repeat and SOCS box containing 14
domestic guinea pig(101787593) ankyrin repeat and SOCS box containing 14
sheep(101103272) ankyrin repeat and SOCS box containing 14
Domestic Rabbit(100353350) ankyrin repeat and SOCS box containing 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301393 ANTI-ASB14 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130387 Rosetta Predictions human pricing
XM_001055574 Rosetta Predictions rat pricing
NM_080856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017284 predicted 769
2 SASI_Hs01_00017285 predicted 609
3 SASI_Hs01_00017286 predicted 647
4 SASI_Hs01_00017288 predicted 289
5 SASI_Hs01_00017289 predicted 458
6 SASI_Hs01_00017290 predicted 391
7 SASI_Hs01_00017291 predicted 904
8 SASI_Hs01_00017292 predicted 475
9 SASI_Hs01_00017293 predicted 300
10 SASI_Hs02_00362709 predicted 424
11 SASI_Hs01_00017287 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280112 predicted 250
2 SASI_Rn02_00280113 predicted 381
3 SASI_Rn02_00280114 predicted 972
4 SASI_Rn02_00280115 predicted 469
5 SASI_Rn02_00280116 predicted 984
6 SASI_Rn02_00280117 predicted 539
7 SASI_Rn02_00280118 predicted 963
8 SASI_Rn02_00280119 predicted 722
9 SASI_Rn02_00280120 predicted 231
10 SASI_Rn02_00280121 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338230 predicted 550
2 SASI_Mm01_00128498 predicted 1465
3 SASI_Mm01_00128499 predicted 1403
4 SASI_Mm01_00128500 predicted 1543
5 SASI_Mm01_00128501 predicted 1619
6 SASI_Mm02_00338231 predicted 883
7 SASI_Mm02_00338232 predicted 580
8 SASI_Mm01_00128502 predicted 1394
9 SASI_Mm01_00128504 predicted 1325
10 SASI_Mm01_00128505 predicted 1423
11 SASI_Mm01_00128503 predicted 574
12 SASI_Mm01_00128506 predicted 460
13 SASI_Mm01_00128507 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130387
ASB14 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-758s21c1
Sequence:CCGGGCCGCCTAAAGATCCGGAAATCTCGAGATTTCCGGATCTTTAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-57s21c1
Sequence:CCGGTACGGATCTTGCTGCCATTAACTCGAGTTAATGGCAGCAAGATCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-825s21c1
Sequence:CCGGTCCATTACCCAATCGTCTAAACTCGAGTTTAGACGATTGGGTAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130387.4-459s1c1
Sequence:CCGGGATGCTGCTGAACTATGGGTACTCGAGTACCCATAGTTCAGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-546s1c1
Sequence:CCGGCTGGACATCTACAGTTATCAACTCGAGTTGATAACTGTAGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130387.4-34s1c1
Sequence:CCGGGCTCTAAAGATACTGATTCCACTCGAGTGGAATCAGTATCTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130387.4-1970s1c1
Sequence:CCGGGCCCTTCATTTGGAAATTCAACTCGAGTTGAATTTCCAAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-855s1c1
Sequence:CCGGCCTTTACAAAGAATACGACCTCTCGAGAGGTCGTATTCTTTGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-631s1c1
Sequence:CCGGCGAGTGATGCTTGATTATGTTCTCGAGAACATAATCAAGCATCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-421s1c1
Sequence:CCGGGCACTGCAATACACTCTGAAACTCGAGTTTCAGAGTGTATTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130387
ASB14 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-758s21c1
Sequence:CCGGGCCGCCTAAAGATCCGGAAATCTCGAGATTTCCGGATCTTTAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-57s21c1
Sequence:CCGGTACGGATCTTGCTGCCATTAACTCGAGTTAATGGCAGCAAGATCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-825s21c1
Sequence:CCGGTCCATTACCCAATCGTCTAAACTCGAGTTTAGACGATTGGGTAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130387.4-459s1c1
Sequence:CCGGGATGCTGCTGAACTATGGGTACTCGAGTACCCATAGTTCAGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-546s1c1
Sequence:CCGGCTGGACATCTACAGTTATCAACTCGAGTTGATAACTGTAGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130387.4-34s1c1
Sequence:CCGGGCTCTAAAGATACTGATTCCACTCGAGTGGAATCAGTATCTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130387.4-1970s1c1
Sequence:CCGGGCCCTTCATTTGGAAATTCAACTCGAGTTGAATTTCCAAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-855s1c1
Sequence:CCGGCCTTTACAAAGAATACGACCTCTCGAGAGGTCGTATTCTTTGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-631s1c1
Sequence:CCGGCGAGTGATGCTTGATTATGTTCTCGAGAACATAATCAAGCATCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-421s1c1
Sequence:CCGGGCACTGCAATACACTCTGAAACTCGAGTTTCAGAGTGTATTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130387
ASB14 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-758s21c1
Sequence:CCGGGCCGCCTAAAGATCCGGAAATCTCGAGATTTCCGGATCTTTAGGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-57s21c1
Sequence:CCGGTACGGATCTTGCTGCCATTAACTCGAGTTAATGGCAGCAAGATCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130387.5-825s21c1
Sequence:CCGGTCCATTACCCAATCGTCTAAACTCGAGTTTAGACGATTGGGTAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130387.4-459s1c1
Sequence:CCGGGATGCTGCTGAACTATGGGTACTCGAGTACCCATAGTTCAGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-546s1c1
Sequence:CCGGCTGGACATCTACAGTTATCAACTCGAGTTGATAACTGTAGATGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130387.4-34s1c1
Sequence:CCGGGCTCTAAAGATACTGATTCCACTCGAGTGGAATCAGTATCTTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130387.4-1970s1c1
Sequence:CCGGGCCCTTCATTTGGAAATTCAACTCGAGTTGAATTTCCAAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-855s1c1
Sequence:CCGGCCTTTACAAAGAATACGACCTCTCGAGAGGTCGTATTCTTTGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-631s1c1
Sequence:CCGGCGAGTGATGCTTGATTATGTTCTCGAGAACATAATCAAGCATCACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130387.4-421s1c1
Sequence:CCGGGCACTGCAATACACTCTGAAACTCGAGTTTCAGAGTGTATTGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080856
ASB14 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-837s1c1
Sequence:CCGGGCGCTACAATACACATTGAAACTCGAGTTTCAATGTGTATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-962s1c1
Sequence:CCGGCTGGACATCTACAGTTATTAACTCGAGTTAATAACTGTAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-1221s1c1
Sequence:CCGGCCCGTCTTCATGTCATTTCTTCTCGAGAAGAAATGACATGAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-590s1c1
Sequence:CCGGGCTGGATCAGAGAATCCGTAACTCGAGTTACGGATTCTCTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-961s1c1
Sequence:CCGGGCTGGACATCTACAGTTATTACTCGAGTAATAACTGTAGATGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080856
ASB14 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-837s1c1
Sequence:CCGGGCGCTACAATACACATTGAAACTCGAGTTTCAATGTGTATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-962s1c1
Sequence:CCGGCTGGACATCTACAGTTATTAACTCGAGTTAATAACTGTAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-1221s1c1
Sequence:CCGGCCCGTCTTCATGTCATTTCTTCTCGAGAAGAAATGACATGAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-590s1c1
Sequence:CCGGGCTGGATCAGAGAATCCGTAACTCGAGTTACGGATTCTCTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-961s1c1
Sequence:CCGGGCTGGACATCTACAGTTATTACTCGAGTAATAACTGTAGATGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080856
ASB14 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-837s1c1
Sequence:CCGGGCGCTACAATACACATTGAAACTCGAGTTTCAATGTGTATTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-962s1c1
Sequence:CCGGCTGGACATCTACAGTTATTAACTCGAGTTAATAACTGTAGATGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-1221s1c1
Sequence:CCGGCCCGTCTTCATGTCATTTCTTCTCGAGAAGAAATGACATGAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-590s1c1
Sequence:CCGGGCTGGATCAGAGAATCCGTAACTCGAGTTACGGATTCTCTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080856.1-961s1c1
Sequence:CCGGGCTGGACATCTACAGTTATTACTCGAGTAATAACTGTAGATGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks