EMAIL THIS PAGE TO A FRIEND

ASB15

ankyrin repeat and SOCS box containing 15

75 Gene Product Result for
UniProtKB ID: Q8WXK1, Q3ZCP3, Q3ZCP5, Q68D37
Gene ID:
Mouse(78910) ankyrin repeat and SOCS box-containing 15
Rat(500050) ankyrin repeat and SOCS box containing 15
sheep(101106002) ankyrin repeat and SOCS box containing 15
Domestic Rabbit(100339061) ankyrin repeat and SOCS box containing 15
domestic guinea pig(100713401) ankyrin repeat and SOCS box containing 15
naked mole-rat(101724009) ankyrin repeat and SOCS box containing 15
chicken(417752) ankyrin repeat and SOCS box containing 15
cow(282591) ankyrin repeat and SOCS box containing 15
Horse(100056427) ankyrin repeat and SOCS box containing 15
domestic cat(101092756) ankyrin repeat and SOCS box containing 15
dog(482279) ankyrin repeat and SOCS box containing 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080928 Rosetta Predictions human pricing
XM_575406 Rosetta Predictions rat pricing
XR_005444 Rosetta Predictions rat pricing
XR_009626 Rosetta Predictions rat pricing
NM_080847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042553 predicted 1391
2 SASI_Hs01_00042554 predicted 1534
3 SASI_Hs01_00042555 predicted 1109
4 SASI_Hs01_00042556 predicted 1296
5 SASI_Hs01_00042557 predicted 725
6 SASI_Hs01_00042558 predicted 334
7 SASI_Hs01_00042559 predicted 924
8 SASI_Hs01_00042560 predicted 662
9 SASI_Hs01_00042561 predicted 1472
10 SASI_Hs02_00362693 predicted 289
11 SASI_Hs01_00042552 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175861 predicted 323
2 SASI_Rn01_00175862 predicted 403
3 SASI_Rn01_00175863 predicted 358
4 SASI_Rn01_00175864 predicted 242
5 SASI_Rn01_00175865 predicted 326
6 SASI_Rn01_00175866 predicted 241
7 SASI_Rn01_00175867 predicted 380
8 SASI_Rn01_00175868 predicted 350
9 SASI_Rn01_00175869 predicted 319
10 SASI_Rn01_00175870 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409266 predicted 399
2 SASI_Rn02_00409267 predicted 206
3 SASI_Rn02_00409268 predicted 536
4 SASI_Rn02_00409269 predicted 356
5 SASI_Rn02_00409270 predicted 341
6 SASI_Rn02_00409271 predicted 324
7 SASI_Rn02_00409272 predicted 731
8 SASI_Rn02_00409273 predicted 628
9 SASI_Rn02_00409274 predicted 372
10 SASI_Rn02_00409275 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420433 predicted 1174
2 SASI_Rn02_00420434 predicted 815
3 SASI_Rn02_00420435 predicted 971
4 SASI_Rn02_00420436 predicted 415
5 SASI_Rn02_00420437 predicted 390
6 SASI_Rn02_00420438 predicted 432
7 SASI_Rn02_00420439 predicted 633
8 SASI_Rn02_00420440 predicted 1611
9 SASI_Rn02_00420441 predicted 685
10 SASI_Rn02_00420442 predicted 1828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046557 predicted 270
2 SASI_Mm01_00046558 predicted 666
3 SASI_Mm01_00046559 predicted 818
4 SASI_Mm01_00046560 predicted 798
5 SASI_Mm01_00046561 predicted 1180
6 SASI_Mm01_00046563 predicted 973
7 SASI_Mm01_00046564 predicted 1614
8 SASI_Mm01_00046565 predicted 773
9 SASI_Mm02_00338220 predicted 693
10 SASI_Mm01_00046566 predicted 963
11 SASI_Mm01_00046562 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080928
ASB15 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-279s1c1
Sequence:CCGGGCAATGGATGAAGCTGATGAACTCGAGTTCATCAGCTTCATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1335s1c1
Sequence:CCGGGCATGGTGACATCTTTGGAAACTCGAGTTTCCAAAGATGTCACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080928.2-373s1c1
Sequence:CCGGCCTATAAGACACTCTGGGAATCTCGAGATTCCCAGAGTGTCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1416s1c1
Sequence:CCGGGCCAAATACTAGAGAATCCTTCTCGAGAAGGATTCTCTAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-168s1c1
Sequence:CCGGGCACTTTGTCCTGAAAGATTTCTCGAGAAATCTTTCAGGACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-312s1c1
Sequence:CCGGCCATTGCATGAAGCTGTTGTTCTCGAGAACAACAGCTTCATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080928.2-321s1c1
Sequence:CCGGGAAGCTGTTGTTCAACCCATTCTCGAGAATGGGTTGAACAACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1281s1c1
Sequence:CCGGGCTGAGGCTATTGCTGAATAACTCGAGTTATTCAGCAATAGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-324s1c1
Sequence:CCGGGCTGTTGTTCAACCCATTCAACTCGAGTTGAATGGGTTGAACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080928
ASB15 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-279s1c1
Sequence:CCGGGCAATGGATGAAGCTGATGAACTCGAGTTCATCAGCTTCATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1335s1c1
Sequence:CCGGGCATGGTGACATCTTTGGAAACTCGAGTTTCCAAAGATGTCACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080928.2-373s1c1
Sequence:CCGGCCTATAAGACACTCTGGGAATCTCGAGATTCCCAGAGTGTCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1416s1c1
Sequence:CCGGGCCAAATACTAGAGAATCCTTCTCGAGAAGGATTCTCTAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-168s1c1
Sequence:CCGGGCACTTTGTCCTGAAAGATTTCTCGAGAAATCTTTCAGGACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-312s1c1
Sequence:CCGGCCATTGCATGAAGCTGTTGTTCTCGAGAACAACAGCTTCATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080928.2-321s1c1
Sequence:CCGGGAAGCTGTTGTTCAACCCATTCTCGAGAATGGGTTGAACAACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1281s1c1
Sequence:CCGGGCTGAGGCTATTGCTGAATAACTCGAGTTATTCAGCAATAGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-324s1c1
Sequence:CCGGGCTGTTGTTCAACCCATTCAACTCGAGTTGAATGGGTTGAACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080928
ASB15 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-279s1c1
Sequence:CCGGGCAATGGATGAAGCTGATGAACTCGAGTTCATCAGCTTCATCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1335s1c1
Sequence:CCGGGCATGGTGACATCTTTGGAAACTCGAGTTTCCAAAGATGTCACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080928.2-373s1c1
Sequence:CCGGCCTATAAGACACTCTGGGAATCTCGAGATTCCCAGAGTGTCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1416s1c1
Sequence:CCGGGCCAAATACTAGAGAATCCTTCTCGAGAAGGATTCTCTAGTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-168s1c1
Sequence:CCGGGCACTTTGTCCTGAAAGATTTCTCGAGAAATCTTTCAGGACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-312s1c1
Sequence:CCGGCCATTGCATGAAGCTGTTGTTCTCGAGAACAACAGCTTCATGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080928.2-321s1c1
Sequence:CCGGGAAGCTGTTGTTCAACCCATTCTCGAGAATGGGTTGAACAACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080928.2-1281s1c1
Sequence:CCGGGCTGAGGCTATTGCTGAATAACTCGAGTTATTCAGCAATAGCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080928.2-324s1c1
Sequence:CCGGGCTGTTGTTCAACCCATTCAACTCGAGTTGAATGGGTTGAACAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080847
ASB15 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1701s1c1
Sequence:CCGGGCCAGAAATACGCCAAATAATCTCGAGATTATTTGGCGTATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1476s1c1
Sequence:CCGGGCACGGAAACATCTTTGGGAACTCGAGTTCCCAAAGATGTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1390s1c1
Sequence:CCGGGCCATTCAGTATGCCCTAAATCTCGAGATTTAGGGCATACTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-376s1c1
Sequence:CCGGGCTGTAGTTCAACCCATTCAACTCGAGTTGAATGGGTTGAACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-212s1c1
Sequence:CCGGGCCAGGCTATATTTCATCCTACTCGAGTAGGATGAAATATAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080847
ASB15 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1701s1c1
Sequence:CCGGGCCAGAAATACGCCAAATAATCTCGAGATTATTTGGCGTATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1476s1c1
Sequence:CCGGGCACGGAAACATCTTTGGGAACTCGAGTTCCCAAAGATGTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1390s1c1
Sequence:CCGGGCCATTCAGTATGCCCTAAATCTCGAGATTTAGGGCATACTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-376s1c1
Sequence:CCGGGCTGTAGTTCAACCCATTCAACTCGAGTTGAATGGGTTGAACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-212s1c1
Sequence:CCGGGCCAGGCTATATTTCATCCTACTCGAGTAGGATGAAATATAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080847
ASB15 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1701s1c1
Sequence:CCGGGCCAGAAATACGCCAAATAATCTCGAGATTATTTGGCGTATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1476s1c1
Sequence:CCGGGCACGGAAACATCTTTGGGAACTCGAGTTCCCAAAGATGTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-1390s1c1
Sequence:CCGGGCCATTCAGTATGCCCTAAATCTCGAGATTTAGGGCATACTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-376s1c1
Sequence:CCGGGCTGTAGTTCAACCCATTCAACTCGAGTTGAATGGGTTGAACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080847.1-212s1c1
Sequence:CCGGGCCAGGCTATATTTCATCCTACTCGAGTAGGATGAAATATAGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks