EMAIL THIS PAGE TO A FRIEND

ASB16-AS1

ASB16 antisense RNA 1

15 Gene Product Result for
Synonyms: C17orf65
Species: Human ASB16-AS1(339201)
UniProtKB ID: Q495Z4, Q495Z5, Q495Z6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301334 ANTI-C17ORF65 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178542 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101191 MISSION® esiRNA esiRNA human C17orf65 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178542 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147112 predicted 1350
2 SASI_Hs01_00147113 predicted 1366
3 SASI_Hs01_00147114 predicted 1315
4 SASI_Hs01_00147115 predicted 1262
5 SASI_Hs01_00147116 predicted 1079
6 SASI_Hs01_00147117 predicted 1350
7 SASI_Hs02_00369777 predicted 1266
8 SASI_Hs01_00147119 predicted 1256
9 SASI_Hs01_00147120 predicted 1165
10 SASI_Hs01_00147121 predicted 1087
11 SASI_Hs01_00147118 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178542
ASB16-AS1 MISSION shRNA Bacterial Glycerol Stock
ASB16 antisense RNA 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178542.3-1372s21c1
Sequence:CCGGAGGTACAGAGCCACATGTTGCCTCGAGGCAACATGTGGCTCTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178542.3-1699s21c1
Sequence:CCGGCTTAAGCCCAGGAGTGATTTGCTCGAGCAAATCACTCCTGGGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178542.3-1581s21c1
Sequence:CCGGTCTCAGCTTGAGGTCCTACCTCTCGAGAGGTAGGACCTCAAGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1836s1c1
Sequence:CCGGCAGTTGTCAGTTGTCTCCTTTCTCGAGAAAGGAGACAACTGACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1633s1c1
Sequence:CCGGCTACAGACAACAGAATTGGAACTCGAGTTCCAATTCTGTTGTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1814s1c1
Sequence:CCGGCAAGGTCTGGTTCTGAATCATCTCGAGATGATTCAGAACCAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1603s1c1
Sequence:CCGGGTGTCCTCCATGAGAATCATACTCGAGTATGATTCTCATGGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1632s1c1
Sequence:CCGGGCTACAGACAACAGAATTGGACTCGAGTCCAATTCTGTTGTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178542
ASB16-AS1 MISSION shRNA shRNA Plasmid DNA
ASB16 antisense RNA 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178542.3-1372s21c1
Sequence:CCGGAGGTACAGAGCCACATGTTGCCTCGAGGCAACATGTGGCTCTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178542.3-1699s21c1
Sequence:CCGGCTTAAGCCCAGGAGTGATTTGCTCGAGCAAATCACTCCTGGGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178542.3-1581s21c1
Sequence:CCGGTCTCAGCTTGAGGTCCTACCTCTCGAGAGGTAGGACCTCAAGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1836s1c1
Sequence:CCGGCAGTTGTCAGTTGTCTCCTTTCTCGAGAAAGGAGACAACTGACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1633s1c1
Sequence:CCGGCTACAGACAACAGAATTGGAACTCGAGTTCCAATTCTGTTGTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1814s1c1
Sequence:CCGGCAAGGTCTGGTTCTGAATCATCTCGAGATGATTCAGAACCAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1603s1c1
Sequence:CCGGGTGTCCTCCATGAGAATCATACTCGAGTATGATTCTCATGGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1632s1c1
Sequence:CCGGGCTACAGACAACAGAATTGGACTCGAGTCCAATTCTGTTGTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178542
ASB16-AS1 MISSION shRNA Lentiviral Transduction Particles
ASB16 antisense RNA 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178542.3-1372s21c1
Sequence:CCGGAGGTACAGAGCCACATGTTGCCTCGAGGCAACATGTGGCTCTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178542.3-1699s21c1
Sequence:CCGGCTTAAGCCCAGGAGTGATTTGCTCGAGCAAATCACTCCTGGGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178542.3-1581s21c1
Sequence:CCGGTCTCAGCTTGAGGTCCTACCTCTCGAGAGGTAGGACCTCAAGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1836s1c1
Sequence:CCGGCAGTTGTCAGTTGTCTCCTTTCTCGAGAAAGGAGACAACTGACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1633s1c1
Sequence:CCGGCTACAGACAACAGAATTGGAACTCGAGTTCCAATTCTGTTGTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1814s1c1
Sequence:CCGGCAAGGTCTGGTTCTGAATCATCTCGAGATGATTCAGAACCAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1603s1c1
Sequence:CCGGGTGTCCTCCATGAGAATCATACTCGAGTATGATTCTCATGGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178542.3-1632s1c1
Sequence:CCGGGCTACAGACAACAGAATTGGACTCGAGTCCAATTCTGTTGTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks