EMAIL THIS PAGE TO A FRIEND

ASB16

ankyrin repeat and SOCS box containing 16

UniProtKB ID: Q96NS5, B2RBC0, Q8WXK0
Gene ID:
Human(92591) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Jul 2008]
Mouse(217217) ankyrin repeat and SOCS box-containing 16
Rat(498005) ankyrin repeat and SOCS box-containing 16
Zebrafish(678621) ankyrin repeat and SOCS box-containing 16
cow(539253) ankyrin repeat and SOCS box containing 16
domestic cat(101084754) ankyrin repeat and SOCS box containing 16
dog(490940) ankyrin repeat and SOCS box containing 16
domestic guinea pig(100722521) ankyrin repeat and SOCS box containing 16
sheep(101115385) ankyrin repeat and SOCS box containing 16
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075561 MISSION® esiRNA esiRNA targeting mouse Asb16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080863 Rosetta Predictions human pricing
NM_001109048 Rosetta Predictions rat pricing
NM_148953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176370 predicted 1179
2 SASI_Hs02_00362637 predicted 1252
3 SASI_Hs01_00176373 predicted 587
4 SASI_Hs02_00362638 predicted 944
5 SASI_Hs01_00176374 predicted 635
6 SASI_Hs01_00176375 predicted 591
7 SASI_Hs01_00176376 predicted 1202
8 SASI_Hs01_00176377 predicted 846
9 SASI_Hs01_00176378 predicted 222
10 SASI_Hs01_00176379 predicted 573
11 SASI_Hs01_00176371 predicted 301
12 SASI_Hs01_00176372 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244610 predicted 1092
2 SASI_Rn02_00244611 predicted 1101
3 SASI_Rn02_00244612 predicted 366
4 SASI_Rn02_00244613 predicted 1047
5 SASI_Rn02_00244614 predicted 553
6 SASI_Rn02_00244615 predicted 1111
7 SASI_Rn02_00244616 predicted 1098
8 SASI_Rn02_00244617 predicted 400
9 SASI_Rn02_00244618 predicted 228
10 SASI_Rn02_00244619 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108519 predicted 1067
2 SASI_Mm01_00108520 predicted 1112
3 SASI_Mm01_00108521 predicted 485
4 SASI_Mm01_00108522 predicted 1047
5 SASI_Mm01_00108523 predicted 600
6 SASI_Mm01_00108524 predicted 552
7 SASI_Mm01_00108525 predicted 536
8 SASI_Mm01_00108526 predicted 1049
9 SASI_Mm01_00108527 predicted 324
10 SASI_Mm02_00342781 predicted 329
11 SASI_Mm01_00108528 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148953
ASB16 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1196s1c1
Sequence:CCGGGCTCAGCTCTAAGCATGGAAACTCGAGTTTCCATGCTTAGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1103s1c1
Sequence:CCGGTCCTCCTTAATGCCTACCCATCTCGAGATGGGTAGGCATTAAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-214s1c1
Sequence:CCGGCAGCTCCAAATCCTGTTCCAACTCGAGTTGGAACAGGATTTGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-403s1c1
Sequence:CCGGGCTGAGCTTGACGCCCGAATTCTCGAGAATTCGGGCGTCAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1065s1c1
Sequence:CCGGGCTGAAACACTGTGCCAACTTCTCGAGAAGTTGGCACAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148953
ASB16 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1196s1c1
Sequence:CCGGGCTCAGCTCTAAGCATGGAAACTCGAGTTTCCATGCTTAGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1103s1c1
Sequence:CCGGTCCTCCTTAATGCCTACCCATCTCGAGATGGGTAGGCATTAAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-214s1c1
Sequence:CCGGCAGCTCCAAATCCTGTTCCAACTCGAGTTGGAACAGGATTTGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-403s1c1
Sequence:CCGGGCTGAGCTTGACGCCCGAATTCTCGAGAATTCGGGCGTCAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1065s1c1
Sequence:CCGGGCTGAAACACTGTGCCAACTTCTCGAGAAGTTGGCACAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148953
ASB16 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1196s1c1
Sequence:CCGGGCTCAGCTCTAAGCATGGAAACTCGAGTTTCCATGCTTAGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1103s1c1
Sequence:CCGGTCCTCCTTAATGCCTACCCATCTCGAGATGGGTAGGCATTAAGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-214s1c1
Sequence:CCGGCAGCTCCAAATCCTGTTCCAACTCGAGTTGGAACAGGATTTGGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-403s1c1
Sequence:CCGGGCTGAGCTTGACGCCCGAATTCTCGAGAATTCGGGCGTCAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148953.1-1065s1c1
Sequence:CCGGGCTGAAACACTGTGCCAACTTCTCGAGAAGTTGGCACAGTGTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080863
ASB16 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080863.4-1602s1c1
Sequence:CCGGCACTGCAACTTCTACCACCTACTCGAGTAGGTGGTAGAAGTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-331s1c1
Sequence:CCGGGCCAACATGATTGTGGAGACTCTCGAGAGTCTCCACAATCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-585s1c1
Sequence:CCGGCAAGGCTAATGTGCTGACTGACTCGAGTCAGTCAGCACATTAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-567s1c1
Sequence:CCGGGCTGCTGACCTTCGGAGCCAACTCGAGTTGGCTCCGAAGGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-339s1c1
Sequence:CCGGGATTGTGGAGACTGTGAGCAACTCGAGTTGCTCACAGTCTCCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-1149s21c1
Sequence:CCGGGCTGAAACACTGCGCCAACTTCTCGAGAAGTTGGCGCAGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-753s21c1
Sequence:CCGGGCAACATGTGGCTCTGTACCTCTCGAGAGGTACAGAGCCACATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-456s21c1
Sequence:CCGGAGACTGTGCTCGACACCTGATCTCGAGATCAGGTGTCGAGCACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080863
ASB16 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080863.4-1602s1c1
Sequence:CCGGCACTGCAACTTCTACCACCTACTCGAGTAGGTGGTAGAAGTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-331s1c1
Sequence:CCGGGCCAACATGATTGTGGAGACTCTCGAGAGTCTCCACAATCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-585s1c1
Sequence:CCGGCAAGGCTAATGTGCTGACTGACTCGAGTCAGTCAGCACATTAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-567s1c1
Sequence:CCGGGCTGCTGACCTTCGGAGCCAACTCGAGTTGGCTCCGAAGGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-339s1c1
Sequence:CCGGGATTGTGGAGACTGTGAGCAACTCGAGTTGCTCACAGTCTCCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-1149s21c1
Sequence:CCGGGCTGAAACACTGCGCCAACTTCTCGAGAAGTTGGCGCAGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-753s21c1
Sequence:CCGGGCAACATGTGGCTCTGTACCTCTCGAGAGGTACAGAGCCACATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-456s21c1
Sequence:CCGGAGACTGTGCTCGACACCTGATCTCGAGATCAGGTGTCGAGCACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080863
ASB16 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080863.4-1602s1c1
Sequence:CCGGCACTGCAACTTCTACCACCTACTCGAGTAGGTGGTAGAAGTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-331s1c1
Sequence:CCGGGCCAACATGATTGTGGAGACTCTCGAGAGTCTCCACAATCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-585s1c1
Sequence:CCGGCAAGGCTAATGTGCTGACTGACTCGAGTCAGTCAGCACATTAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-567s1c1
Sequence:CCGGGCTGCTGACCTTCGGAGCCAACTCGAGTTGGCTCCGAAGGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080863.4-339s1c1
Sequence:CCGGGATTGTGGAGACTGTGAGCAACTCGAGTTGCTCACAGTCTCCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-1149s21c1
Sequence:CCGGGCTGAAACACTGCGCCAACTTCTCGAGAAGTTGGCGCAGTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-753s21c1
Sequence:CCGGGCAACATGTGGCTCTGTACCTCTCGAGAGGTACAGAGCCACATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080863.4-456s21c1
Sequence:CCGGAGACTGTGCTCGACACCTGATCTCGAGATCAGGTGTCGAGCACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks