EMAIL THIS PAGE TO A FRIEND

ASB17

ankyrin repeat and SOCS box containing 17

46 Gene Product Result for
Synonyms: Asb-17
UniProtKB ID: Q8WXJ9, B1APB8, Q8N0X5
Gene ID:
Mouse(66772) ankyrin repeat and SOCS box-containing 17
Rat(687364) ankyrin repeat and SOCS box-containing 17
dog(403539) ankyrin repeat and SOCS box containing 17
domestic cat(101090788) ankyrin repeat and SOCS box containing 17
cow(616654) ankyrin repeat and SOCS box containing 17
sheep(101121217) ankyrin repeat and SOCS box containing 17
domestic guinea pig(100716031) ankyrin repeat and SOCS box containing 17
naked mole-rat(101709228) ankyrin repeat and SOCS box containing 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303342 ANTI-ASB17 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB2105844 Anti-ASB17 antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080868 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080868 Rosetta Predictions human pricing
NM_001109676 Rosetta Predictions rat pricing
NM_025758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145693 predicted 453
2 SASI_Hs01_00145694 predicted 708
3 SASI_Hs01_00145695 predicted 724
4 SASI_Hs01_00145696 predicted 535
5 SASI_Hs01_00145697 predicted 675
6 SASI_Hs01_00145699 predicted 256
7 SASI_Hs01_00145700 predicted 700
8 SASI_Hs01_00145701 predicted 521
9 SASI_Hs02_00362661 predicted 846
10 SASI_Hs02_00362662 predicted 295
11 SASI_Hs01_00145698 predicted 417
12 SASI_Hs01_00145702 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250622 predicted 699
2 SASI_Rn02_00250623 predicted 243
3 SASI_Rn02_00250624 predicted 608
4 SASI_Rn02_00250625 predicted 517
5 SASI_Rn02_00250626 predicted 544
6 SASI_Rn02_00250627 predicted 549
7 SASI_Rn02_00250628 predicted 681
8 SASI_Rn02_00250629 predicted 632
9 SASI_Rn02_00250630 predicted 356
10 SASI_Rn02_00250631 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113580 predicted 772
2 SASI_Mm01_00113582 predicted 203
3 SASI_Mm01_00113583 predicted 614
4 SASI_Mm01_00113584 predicted 269
5 SASI_Mm01_00113585 predicted 336
6 SASI_Mm01_00113586 predicted 698
7 SASI_Mm01_00113587 predicted 811
8 SASI_Mm01_00113588 predicted 620
9 SASI_Mm02_00328958 predicted 641
10 SASI_Mm01_00113589 predicted 398
11 SASI_Mm01_00113581 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025758
ASB17 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 17
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.2-705s1c1
Sequence:CCGGGCCAAGACATGTTTAATGCTACTCGAGTAGCATTAAACATGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.2-681s1c1
Sequence:CCGGGAGTTGATTGACATTCAAGAACTCGAGTTCTTGAATGTCAATCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-780s21c1
Sequence:CCGGTTAGGACGACGCCCAATTATTCTCGAGAATAATTGGGCGTCGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-210s21c1
Sequence:CCGGTGCTATGAACCCAGGATTTACCTCGAGGTAAATCCTGGGTTCATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-279s21c1
Sequence:CCGGATACTCCTCACGGACTATATTCTCGAGAATATAGTCCGTGAGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.4-556s1c1
Sequence:CCGGCAAGACAGTCAAATATCTTAACTCGAGTTAAGATATTTGACTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.4-150s1c1
Sequence:CCGGCTTGTTGACAAGATAGTTAAGCTCGAGCTTAACTATCTTGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-352s21c1
Sequence:CCGGTTACTGAAATATGCGTGAATACTCGAGTATTCACGCATATTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-629s21c1
Sequence:CCGGTGTTCTGACAATACTACTTTACTCGAGTAAAGTAGTATTGTCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025758
ASB17 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 17
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.2-705s1c1
Sequence:CCGGGCCAAGACATGTTTAATGCTACTCGAGTAGCATTAAACATGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.2-681s1c1
Sequence:CCGGGAGTTGATTGACATTCAAGAACTCGAGTTCTTGAATGTCAATCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-780s21c1
Sequence:CCGGTTAGGACGACGCCCAATTATTCTCGAGAATAATTGGGCGTCGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-210s21c1
Sequence:CCGGTGCTATGAACCCAGGATTTACCTCGAGGTAAATCCTGGGTTCATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-279s21c1
Sequence:CCGGATACTCCTCACGGACTATATTCTCGAGAATATAGTCCGTGAGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.4-556s1c1
Sequence:CCGGCAAGACAGTCAAATATCTTAACTCGAGTTAAGATATTTGACTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.4-150s1c1
Sequence:CCGGCTTGTTGACAAGATAGTTAAGCTCGAGCTTAACTATCTTGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-352s21c1
Sequence:CCGGTTACTGAAATATGCGTGAATACTCGAGTATTCACGCATATTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-629s21c1
Sequence:CCGGTGTTCTGACAATACTACTTTACTCGAGTAAAGTAGTATTGTCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025758
ASB17 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 17
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.2-705s1c1
Sequence:CCGGGCCAAGACATGTTTAATGCTACTCGAGTAGCATTAAACATGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.2-681s1c1
Sequence:CCGGGAGTTGATTGACATTCAAGAACTCGAGTTCTTGAATGTCAATCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-780s21c1
Sequence:CCGGTTAGGACGACGCCCAATTATTCTCGAGAATAATTGGGCGTCGTCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-210s21c1
Sequence:CCGGTGCTATGAACCCAGGATTTACCTCGAGGTAAATCCTGGGTTCATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-279s21c1
Sequence:CCGGATACTCCTCACGGACTATATTCTCGAGAATATAGTCCGTGAGGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.4-556s1c1
Sequence:CCGGCAAGACAGTCAAATATCTTAACTCGAGTTAAGATATTTGACTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025758.4-150s1c1
Sequence:CCGGCTTGTTGACAAGATAGTTAAGCTCGAGCTTAACTATCTTGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-352s21c1
Sequence:CCGGTTACTGAAATATGCGTGAATACTCGAGTATTCACGCATATTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025758.4-629s21c1
Sequence:CCGGTGTTCTGACAATACTACTTTACTCGAGTAAAGTAGTATTGTCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080868
ASB17 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-332s1c1
Sequence:CCGGCGCACTACTCACAGATTACATCTCGAGATGTAATCTGTGAGTAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-172s1c1
Sequence:CCGGCTTCTTGTCCAAGAAGCAATACTCGAGTATTGCTTCTTGGACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-467s1c1
Sequence:CCGGCTTTGTGGAATTGCTTCTCAACTCGAGTTGAGAAGCAATTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-603s1c1
Sequence:CCGGGCTCAGACAAGACAGTCTAATCTCGAGATTAGACTGTCTTGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-774s1c1
Sequence:CCGGGTACTATGTTCCAGAGTGCTTCTCGAGAAGCACTCTGGAACATAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-957s21c1
Sequence:CCGGATGCTCCCAGATGGAATATTTCTCGAGAAATATTCCATCTGGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-397s21c1
Sequence:CCGGACCTCGACTTCACTGAAATATCTCGAGATATTTCAGTGAAGTCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-720s21c1
Sequence:CCGGGTAATGGTTGATCGTGAATTGCTCGAGCAATTCACGATCAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080868
ASB17 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-332s1c1
Sequence:CCGGCGCACTACTCACAGATTACATCTCGAGATGTAATCTGTGAGTAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-172s1c1
Sequence:CCGGCTTCTTGTCCAAGAAGCAATACTCGAGTATTGCTTCTTGGACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-467s1c1
Sequence:CCGGCTTTGTGGAATTGCTTCTCAACTCGAGTTGAGAAGCAATTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-603s1c1
Sequence:CCGGGCTCAGACAAGACAGTCTAATCTCGAGATTAGACTGTCTTGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-774s1c1
Sequence:CCGGGTACTATGTTCCAGAGTGCTTCTCGAGAAGCACTCTGGAACATAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-957s21c1
Sequence:CCGGATGCTCCCAGATGGAATATTTCTCGAGAAATATTCCATCTGGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-397s21c1
Sequence:CCGGACCTCGACTTCACTGAAATATCTCGAGATATTTCAGTGAAGTCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-720s21c1
Sequence:CCGGGTAATGGTTGATCGTGAATTGCTCGAGCAATTCACGATCAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080868
ASB17 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-332s1c1
Sequence:CCGGCGCACTACTCACAGATTACATCTCGAGATGTAATCTGTGAGTAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-172s1c1
Sequence:CCGGCTTCTTGTCCAAGAAGCAATACTCGAGTATTGCTTCTTGGACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-467s1c1
Sequence:CCGGCTTTGTGGAATTGCTTCTCAACTCGAGTTGAGAAGCAATTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-603s1c1
Sequence:CCGGGCTCAGACAAGACAGTCTAATCTCGAGATTAGACTGTCTTGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080868.1-774s1c1
Sequence:CCGGGTACTATGTTCCAGAGTGCTTCTCGAGAAGCACTCTGGAACATAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-957s21c1
Sequence:CCGGATGCTCCCAGATGGAATATTTCTCGAGAAATATTCCATCTGGGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-397s21c1
Sequence:CCGGACCTCGACTTCACTGAAATATCTCGAGATATTTCAGTGAAGTCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080868.2-720s21c1
Sequence:CCGGGTAATGGTTGATCGTGAATTGCTCGAGCAATTCACGATCAACCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks