EMAIL THIS PAGE TO A FRIEND

ASB18

ankyrin repeat and SOCS box containing 18

71 Gene Product Result for
Synonyms: ASB-18
UniProtKB ID: Q6ZVZ8, B6ZDL7
Gene ID:
Mouse(208372) ankyrin repeat and SOCS box-containing 18
Rat(316614) ankyrin repeat and SOCS box-containing 18
naked mole-rat(101698733) ankyrin repeat and SOCS box containing 18
domestic guinea pig(100717207) ankyrin repeat and SOCS box containing 18
sheep(101103518) ankyrin repeat and SOCS box containing 18
chicken(424022) ankyrin repeat and SOCS box containing 18
dog(486175) ankyrin repeat and SOCS box containing 18
cow(100141009) ankyrin repeat and SOCS box containing 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_212556 Rosetta Predictions human pricing
NM_001108231 Rosetta Predictions rat pricing
XM_237383 Rosetta Predictions rat pricing
NM_139152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374238 predicted 1038
2 SASI_Hs02_00374239 predicted 1118
3 SASI_Hs01_00130081 predicted 1098
4 SASI_Hs02_00374240 predicted 951
5 SASI_Hs01_00130083 predicted 1153
6 SASI_Hs02_00374241 predicted 944
7 SASI_Hs02_00374242 predicted 1151
8 SASI_Hs02_00374243 predicted 910
9 SASI_Hs02_00374244 predicted 950
10 SASI_Hs02_00374245 predicted 1149
11 SASI_Hs01_00130078 predicted 270
12 SASI_Hs01_00130079 predicted 653
13 SASI_Hs01_00130080 predicted 715
14 SASI_Hs01_00130082 predicted 275
15 SASI_Hs01_00130084 predicted 702
16 SASI_Hs01_00130085 predicted 667
17 SASI_Hs01_00130086 predicted 742
18 SASI_Hs01_00130087 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236614 predicted 1148
2 SASI_Rn02_00236615 predicted 1035
3 SASI_Rn02_00236616 predicted 274
4 SASI_Rn02_00236617 predicted 203
5 SASI_Rn02_00236618 predicted 408
6 SASI_Rn02_00236619 predicted 693
7 SASI_Rn02_00236620 predicted 230
8 SASI_Rn02_00236621 predicted 1220
9 SASI_Rn02_00236622 predicted 260
10 SASI_Rn02_00236623 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125335 predicted 1532
2 SASI_Rn01_00125336 predicted 1286
3 SASI_Rn01_00125337 predicted 536
4 SASI_Rn01_00125338 predicted 1455
5 SASI_Rn01_00125339 predicted 558
6 SASI_Rn01_00125340 predicted 456
7 SASI_Rn01_00125341 predicted 931
8 SASI_Rn01_00125342 predicted 480
9 SASI_Rn01_00125343 predicted 396
10 SASI_Rn01_00125344 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037254 predicted 251
2 SASI_Mm01_00037255 predicted 1119
3 SASI_Mm01_00037256 predicted 282
4 SASI_Mm01_00037257 predicted 1137
5 SASI_Mm01_00037258 predicted 400
6 SASI_Mm01_00037259 predicted 525
7 SASI_Mm01_00037260 predicted 276
8 SASI_Mm01_00037261 predicted 232
9 SASI_Mm01_00037262 predicted 420
10 SASI_Mm02_00339916 predicted 524
11 SASI_Mm01_00037253 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376185
ASB18 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376185.1-1927s1c1
Sequence:CCGGGCCCAGGAATCAGTCTTGTTTCTCGAGAAACAAGACTGATTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-291s1c1
Sequence:CCGGGAGATGGAATGGCAGGTGAAACTCGAGTTTCACCTGCCATTCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-265s1c1
Sequence:CCGGACGTGGTGTTTGAGATCAATACTCGAGTATTGATCTCAAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-649s1c1
Sequence:CCGGGAGTCCTGGAAGGAAGTGATTCTCGAGAATCACTTCCTTCCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-266s1c1
Sequence:CCGGCGTGGTGTTTGAGATCAATAACTCGAGTTATTGATCTCAAACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376185
ASB18 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376185.1-1927s1c1
Sequence:CCGGGCCCAGGAATCAGTCTTGTTTCTCGAGAAACAAGACTGATTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-291s1c1
Sequence:CCGGGAGATGGAATGGCAGGTGAAACTCGAGTTTCACCTGCCATTCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-265s1c1
Sequence:CCGGACGTGGTGTTTGAGATCAATACTCGAGTATTGATCTCAAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-649s1c1
Sequence:CCGGGAGTCCTGGAAGGAAGTGATTCTCGAGAATCACTTCCTTCCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-266s1c1
Sequence:CCGGCGTGGTGTTTGAGATCAATAACTCGAGTTATTGATCTCAAACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376185
ASB18 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376185.1-1927s1c1
Sequence:CCGGGCCCAGGAATCAGTCTTGTTTCTCGAGAAACAAGACTGATTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-291s1c1
Sequence:CCGGGAGATGGAATGGCAGGTGAAACTCGAGTTTCACCTGCCATTCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-265s1c1
Sequence:CCGGACGTGGTGTTTGAGATCAATACTCGAGTATTGATCTCAAACACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-649s1c1
Sequence:CCGGGAGTCCTGGAAGGAAGTGATTCTCGAGAATCACTTCCTTCCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376185.1-266s1c1
Sequence:CCGGCGTGGTGTTTGAGATCAATAACTCGAGTTATTGATCTCAAACACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139152
ASB18 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-38s1c1
Sequence:CCGGGCTCAGACATAGTGAGGAGATCTCGAGATCTCCTCACTATGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-258s1c1
Sequence:CCGGCGCGGTGTTTGAGATCAGTAACTCGAGTTACTGATCTCAAACACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-131s1c1
Sequence:CCGGACGCCGTAATAGAACTTGCTACTCGAGTAGCAAGTTCTATTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-133s1c1
Sequence:CCGGGCCGTAATAGAACTTGCTAATCTCGAGATTAGCAAGTTCTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-1227s1c1
Sequence:CCGGGCCTTTCTACAGGTCTCTCTTCTCGAGAAGAGAGACCTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139152
ASB18 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-38s1c1
Sequence:CCGGGCTCAGACATAGTGAGGAGATCTCGAGATCTCCTCACTATGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-258s1c1
Sequence:CCGGCGCGGTGTTTGAGATCAGTAACTCGAGTTACTGATCTCAAACACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-131s1c1
Sequence:CCGGACGCCGTAATAGAACTTGCTACTCGAGTAGCAAGTTCTATTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-133s1c1
Sequence:CCGGGCCGTAATAGAACTTGCTAATCTCGAGATTAGCAAGTTCTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-1227s1c1
Sequence:CCGGGCCTTTCTACAGGTCTCTCTTCTCGAGAAGAGAGACCTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139152
ASB18 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-38s1c1
Sequence:CCGGGCTCAGACATAGTGAGGAGATCTCGAGATCTCCTCACTATGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-258s1c1
Sequence:CCGGCGCGGTGTTTGAGATCAGTAACTCGAGTTACTGATCTCAAACACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-131s1c1
Sequence:CCGGACGCCGTAATAGAACTTGCTACTCGAGTAGCAAGTTCTATTACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-133s1c1
Sequence:CCGGGCCGTAATAGAACTTGCTAATCTCGAGATTAGCAAGTTCTATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139152.1-1227s1c1
Sequence:CCGGGCCTTTCTACAGGTCTCTCTTCTCGAGAAGAGAGACCTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks