EMAIL THIS PAGE TO A FRIEND

ASB1

ankyrin repeat and SOCS box containing 1

71 Gene Product Result for
Synonyms: ASB-1
UniProtKB ID: Q9Y576, A6NL50, Q4ZG29, Q9ULS4
Gene ID:
Human(51665) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. [provided by RefSeq, Jul 2008]
Mouse(65247) ankyrin repeat and SOCS box-containing 1
Rat(316628) ankyrin repeat and SOCS box-containing 1
Zebrafish(554673) ankyrin repeat and SOCS box-containing 1
cow(617358) ankyrin repeat and SOCS box containing 1
domestic cat(101089206) ankyrin repeat and SOCS box containing 1
dog(486182) ankyrin repeat and SOCS box containing 1
chicken(424030) ankyrin repeat and SOCS box containing 1
Thale Cress(839103) anthranilate synthase beta subunit 1
sheep(101108274) ankyrin repeat and SOCS box containing 1
domestic guinea pig(100727879) ankyrin repeat and SOCS box containing 1
naked mole-rat(101725655) ankyrin repeat and SOCS box containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003508 Anti-ASB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016114 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040445 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040445 Rosetta Predictions human pricing
NM_001108232 Rosetta Predictions rat pricing
NM_001039126 Rosetta Predictions mouse pricing
NM_023046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204361 predicted 1429
2 SASI_Hs01_00204362 predicted 424
3 SASI_Hs01_00204363 predicted 1483
4 SASI_Hs01_00204364 predicted 1464
5 SASI_Hs01_00204365 predicted 1395
6 SASI_Hs01_00204366 predicted 1108
7 SASI_Hs01_00204367 predicted 1311
8 SASI_Hs01_00204368 predicted 756
9 SASI_Hs01_00204369 predicted 551
10 SASI_Hs02_00308984 predicted 1012
11 SASI_Hs01_00204370 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236624 predicted 1485
2 SASI_Rn02_00236625 predicted 1087
3 SASI_Rn02_00236626 predicted 1184
4 SASI_Rn02_00236627 predicted 1705
5 SASI_Rn02_00236628 predicted 1341
6 SASI_Rn02_00236629 predicted 979
7 SASI_Rn02_00236630 predicted 1718
8 SASI_Rn02_00236631 predicted 1306
9 SASI_Rn02_00236632 predicted 813
10 SASI_Rn02_00236633 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289817 predicted 589
2 SASI_Mm02_00289818 predicted 916
3 SASI_Mm02_00289819 predicted 1253
4 SASI_Mm02_00289820 predicted 748
5 SASI_Mm02_00289821 predicted 1146
6 SASI_Mm02_00289822 predicted 1454
7 SASI_Mm02_00289823 predicted 896
8 SASI_Mm02_00289824 predicted 1270
9 SASI_Mm02_00289825 predicted 1146
10 SASI_Mm02_00289826 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140179 predicted 393
2 SASI_Mm01_00140180 predicted 723
3 SASI_Mm02_00326742 predicted 1053
4 SASI_Mm01_00140181 predicted 546
5 SASI_Mm01_00140182 predicted 947
6 SASI_Mm01_00140183 predicted 1254
7 SASI_Mm01_00140184 predicted 696
8 SASI_Mm01_00140185 predicted 1078
9 SASI_Mm02_00326743 predicted 945
10 SASI_Mm01_00140187 predicted 1038
11 SASI_Mm01_00140186 predicted 1163
12 SASI_Mm01_00140188 predicted 1274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023046
ASB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000179862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023046.2-1037s1c1
Sequence:CCGGCAGCTATTAGAGCTGCTCTTTCTCGAGAAAGAGCAGCTCTAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-530s1c1
Sequence:CCGGCTGAAGGCTCTTATCAGGTATCTCGAGATACCTGATAAGAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-980s1c1
Sequence:CCGGGCCAGTGAGATGTAGTACAAACTCGAGTTTGTACTACATCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-902s1c1
Sequence:CCGGGAGGCCTTGCAGGTCTTTAAACTCGAGTTTAAAGACCTGCAAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023046
ASB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000179862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023046.2-1037s1c1
Sequence:CCGGCAGCTATTAGAGCTGCTCTTTCTCGAGAAAGAGCAGCTCTAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-530s1c1
Sequence:CCGGCTGAAGGCTCTTATCAGGTATCTCGAGATACCTGATAAGAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-980s1c1
Sequence:CCGGGCCAGTGAGATGTAGTACAAACTCGAGTTTGTACTACATCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-902s1c1
Sequence:CCGGGAGGCCTTGCAGGTCTTTAAACTCGAGTTTAAAGACCTGCAAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023046
ASB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000179862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023046.2-1037s1c1
Sequence:CCGGCAGCTATTAGAGCTGCTCTTTCTCGAGAAAGAGCAGCTCTAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-530s1c1
Sequence:CCGGCTGAAGGCTCTTATCAGGTATCTCGAGATACCTGATAAGAGCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-980s1c1
Sequence:CCGGGCCAGTGAGATGTAGTACAAACTCGAGTTTGTACTACATCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023046.2-902s1c1
Sequence:CCGGGAGGCCTTGCAGGTCTTTAAACTCGAGTTTAAAGACCTGCAAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016114
VALIDATED
ASB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-5705s1c1
Sequence:CCGGCGGAGAGGAATGTGCAGATTTCTCGAGAAATCTGCACATTCCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016114.3-904s1c1
Sequence:CCGGCAGAGTCGAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTCGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-2321s1c1
Sequence:CCGGCGCAGATTTCAAATCTGTGTTCTCGAGAACACAGATTTGAAATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-3699s1c1
Sequence:CCGGGCTGCCAAATATGAATCTGAACTCGAGTTCAGATTCATATTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016114.3-962s1c1
Sequence:CCGGCAGAAGTGTTCCCAGAACCTTCTCGAGAAGGTTCTGGGAACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016114
VALIDATED
ASB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-5705s1c1
Sequence:CCGGCGGAGAGGAATGTGCAGATTTCTCGAGAAATCTGCACATTCCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016114.3-904s1c1
Sequence:CCGGCAGAGTCGAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTCGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-2321s1c1
Sequence:CCGGCGCAGATTTCAAATCTGTGTTCTCGAGAACACAGATTTGAAATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-3699s1c1
Sequence:CCGGGCTGCCAAATATGAATCTGAACTCGAGTTCAGATTCATATTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016114.3-962s1c1
Sequence:CCGGCAGAAGTGTTCCCAGAACCTTCTCGAGAAGGTTCTGGGAACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016114
VALIDATED
ASB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-5705s1c1
Sequence:CCGGCGGAGAGGAATGTGCAGATTTCTCGAGAAATCTGCACATTCCTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016114.3-904s1c1
Sequence:CCGGCAGAGTCGAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTCGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-2321s1c1
Sequence:CCGGCGCAGATTTCAAATCTGTGTTCTCGAGAACACAGATTTGAAATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128327    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016114.3-3699s1c1
Sequence:CCGGGCTGCCAAATATGAATCTGAACTCGAGTTCAGATTCATATTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016114.3-962s1c1
Sequence:CCGGCAGAAGTGTTCCCAGAACCTTCTCGAGAAGGTTCTGGGAACACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040445
VALIDATED
ASB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040445.1-843s21c1
Sequence:CCGGGTGAGCCTGCTGGTAGAATTTCTCGAGAAATTCTACCAGCAGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040445.1-1466s21c1
Sequence:CCGGCAATTTGATGGTTCGATTAAACTCGAGTTTAATCGAACCATCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-866s21c1
Sequence:CCGGAGCCAACCTGAATCTAGTGAACTCGAGTTCACTAGATTCAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-620s21c1
Sequence:CCGGTGATGTCCAGCCTCGATTCTCCTCGAGGAGAATCGAGGCTGGACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-904s21c1
Sequence:CCGGCAGAGTCGAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTCGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040445
VALIDATED
ASB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040445.1-843s21c1
Sequence:CCGGGTGAGCCTGCTGGTAGAATTTCTCGAGAAATTCTACCAGCAGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040445.1-1466s21c1
Sequence:CCGGCAATTTGATGGTTCGATTAAACTCGAGTTTAATCGAACCATCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-866s21c1
Sequence:CCGGAGCCAACCTGAATCTAGTGAACTCGAGTTCACTAGATTCAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-620s21c1
Sequence:CCGGTGATGTCCAGCCTCGATTCTCCTCGAGGAGAATCGAGGCTGGACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-904s21c1
Sequence:CCGGCAGAGTCGAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTCGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040445
VALIDATED
ASB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040445.1-843s21c1
Sequence:CCGGGTGAGCCTGCTGGTAGAATTTCTCGAGAAATTCTACCAGCAGGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040445.1-1466s21c1
Sequence:CCGGCAATTTGATGGTTCGATTAAACTCGAGTTTAATCGAACCATCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-866s21c1
Sequence:CCGGAGCCAACCTGAATCTAGTGAACTCGAGTTCACTAGATTCAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-620s21c1
Sequence:CCGGTGATGTCCAGCCTCGATTCTCCTCGAGGAGAATCGAGGCTGGACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_001040445.1-904s21c1
Sequence:CCGGCAGAGTCGAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTCGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks