EMAIL THIS PAGE TO A FRIEND

ASB2

ankyrin repeat and SOCS box containing 2

60 Gene Product Result for
Synonyms: ASB-2
UniProtKB ID: Q96Q27, B2RDP9, B4E166, Q9NSU5, Q9Y567
Gene ID:
Human(51676) Summary: This gene encodes a member of the ankyrin repeat and SOCS box-containing (ASB) protein family. These proteins play a role in protein degradation by coupling suppressor of cytokine signalling (SOCS) proteins with the elongin BC complex. The encoded protein is a subunit of a multimeric E3 ubiquitin ligase complex that mediates the degradation of actin-binding proteins. This gene plays a role in retinoic acid-induced growth inhibition and differentiation of myeloid leukemia cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(65256) ankyrin repeat and SOCS box-containing 2
Rat(299266) ankyrin repeat and SOCS box-containing 2
chicken(423428) ankyrin repeat and SOCS box containing 2
dog(490836) ankyrin repeat and SOCS box containing 2
cow(539244) ankyrin repeat and SOCS box containing 2
Horse(100064381) ankyrin repeat and SOCS box containing 2
domestic cat(101101572) ankyrin repeat and SOCS box containing 2
sheep(101114059) ankyrin repeat and SOCS box containing 2
domestic guinea pig(100735515) ankyrin repeat and SOCS box containing 2
naked mole-rat(101706168) ankyrin repeat and SOCS box containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0129 AQUA Peptide DGLLPLHIAS[K] dog, human pricing
AQ0130 AQUA Peptide FDVNTPLAPE[R] human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016150 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016150 Rosetta Predictions human pricing
NM_001011984 Rosetta Predictions rat pricing
XM_576093 Rosetta Predictions rat pricing
NM_023049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348949 predicted 2214
2 SASI_Hs01_00177849 predicted 1385
3 SASI_Hs01_00177850 predicted 2443
4 SASI_Hs01_00177851 predicted 1580
5 SASI_Hs01_00177852 predicted 2150
6 SASI_Hs02_00348950 predicted 2279
7 SASI_Hs02_00348951 predicted 2280
8 SASI_Hs02_00348952 predicted 1087
9 SASI_Hs01_00177853 predicted 1214
10 SASI_Hs01_00177854 predicted 2426
11 SASI_Hs01_00177847 predicted 705
12 SASI_Hs01_00177848 predicted 2464
13 SASI_Hs01_00177855 predicted 716
14 SASI_Hs01_00177856 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060893 predicted 1211
2 SASI_Rn01_00060894 predicted 1629
3 SASI_Rn01_00060895 predicted 2039
4 SASI_Rn01_00060896 predicted 836
5 SASI_Rn01_00060897 predicted 701
6 SASI_Rn01_00060898 predicted 536
7 SASI_Rn01_00060899 predicted 1906
8 SASI_Rn01_00060900 predicted 648
9 SASI_Rn01_00060901 predicted 912
10 SASI_Rn02_00200012 predicted 1417
11 SASI_Rn01_00060892 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171783 predicted 1667
2 SASI_Rn01_00171784 predicted 1320
3 SASI_Rn01_00171785 predicted 1728
4 SASI_Rn01_00171786 predicted 2138
5 SASI_Rn01_00171787 predicted 941
6 SASI_Rn01_00171788 predicted 796
7 SASI_Rn01_00171789 predicted 639
8 SASI_Rn01_00171790 predicted 2008
9 SASI_Rn01_00171791 predicted 753
10 SASI_Rn01_00171792 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180075 predicted 1841
2 SASI_Mm01_00180076 predicted 1427
3 SASI_Mm02_00326747 predicted 2285
4 SASI_Mm01_00180078 predicted 1854
5 SASI_Mm01_00180079 predicted 408
6 SASI_Mm01_00180081 predicted 2113
7 SASI_Mm01_00180082 predicted 2307
8 SASI_Mm01_00180083 predicted 1051
9 SASI_Mm01_00180084 predicted 1328
10 SASI_Mm02_00326748 predicted 1123
11 SASI_Mm01_00180077 predicted 1828
12 SASI_Mm01_00180080 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023049
ASB2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023049.1-2391s1c1
Sequence:CCGGGCTGGTTCTTTGCTGGAGCTTCTCGAGAAGCTCCAGCAAAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-2258s1c1
Sequence:CCGGGCTAATCAGATACCTGAAATACTCGAGTATTTCAGGTATCTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-1419s1c1
Sequence:CCGGGCCTCCAAGAAGGGCAACTATCTCGAGATAGTTGCCCTTCTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-2255s1c1
Sequence:CCGGCAGGCTAATCAGATACCTGAACTCGAGTTCAGGTATCTGATTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-1373s1c1
Sequence:CCGGCGATGCTAACAAAGCCAACAACTCGAGTTGTTGGCTTTGTTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-1856s21c1
Sequence:CCGGGTCGTTACTCAAGTTCCTTATCTCGAGATAAGGAACTTGAGTAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-434s21c1
Sequence:CCGGACATGAGGAATACAGCCTATACTCGAGTATAGGCTGTATTCCTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-1312s21c1
Sequence:CCGGTCTACGAGGCCAGCAAGAATGCTCGAGCATTCTTGCTGGCCTCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-979s21c1
Sequence:CCGGAGCCTGACATCTCTAACAAATCTCGAGATTTGTTAGAGATGTCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023049
ASB2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023049.1-2391s1c1
Sequence:CCGGGCTGGTTCTTTGCTGGAGCTTCTCGAGAAGCTCCAGCAAAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-2258s1c1
Sequence:CCGGGCTAATCAGATACCTGAAATACTCGAGTATTTCAGGTATCTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-1419s1c1
Sequence:CCGGGCCTCCAAGAAGGGCAACTATCTCGAGATAGTTGCCCTTCTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-2255s1c1
Sequence:CCGGCAGGCTAATCAGATACCTGAACTCGAGTTCAGGTATCTGATTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-1373s1c1
Sequence:CCGGCGATGCTAACAAAGCCAACAACTCGAGTTGTTGGCTTTGTTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-1856s21c1
Sequence:CCGGGTCGTTACTCAAGTTCCTTATCTCGAGATAAGGAACTTGAGTAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-434s21c1
Sequence:CCGGACATGAGGAATACAGCCTATACTCGAGTATAGGCTGTATTCCTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-1312s21c1
Sequence:CCGGTCTACGAGGCCAGCAAGAATGCTCGAGCATTCTTGCTGGCCTCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-979s21c1
Sequence:CCGGAGCCTGACATCTCTAACAAATCTCGAGATTTGTTAGAGATGTCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023049
ASB2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023049.1-2391s1c1
Sequence:CCGGGCTGGTTCTTTGCTGGAGCTTCTCGAGAAGCTCCAGCAAAGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-2258s1c1
Sequence:CCGGGCTAATCAGATACCTGAAATACTCGAGTATTTCAGGTATCTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-1419s1c1
Sequence:CCGGGCCTCCAAGAAGGGCAACTATCTCGAGATAGTTGCCCTTCTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-2255s1c1
Sequence:CCGGCAGGCTAATCAGATACCTGAACTCGAGTTCAGGTATCTGATTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023049.1-1373s1c1
Sequence:CCGGCGATGCTAACAAAGCCAACAACTCGAGTTGTTGGCTTTGTTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-1856s21c1
Sequence:CCGGGTCGTTACTCAAGTTCCTTATCTCGAGATAAGGAACTTGAGTAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-434s21c1
Sequence:CCGGACATGAGGAATACAGCCTATACTCGAGTATAGGCTGTATTCCTCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-1312s21c1
Sequence:CCGGTCTACGAGGCCAGCAAGAATGCTCGAGCATTCTTGCTGGCCTCGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023049.1-979s21c1
Sequence:CCGGAGCCTGACATCTCTAACAAATCTCGAGATTTGTTAGAGATGTCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016150
ASB2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2217s1c1
Sequence:CCGGGCTGATTAGATACCTGAAATACTCGAGTATTTCAGGTATCTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2430s1c1
Sequence:CCGGGCAGAGAACAGAATGTGTCAACTCGAGTTGACACATTCTGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2064s1c1
Sequence:CCGGGAAGGAACACATCGACAGCTTCTCGAGAAGCTGTCGATGTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-615s1c1
Sequence:CCGGGCAGAAATACAGCAGCAGCTTCTCGAGAAGCTGCTGCTGTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2281s1c1
Sequence:CCGGCCCTCAGACTCTTCTTACTAACTCGAGTTAGTAAGAAGAGTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2440s1c1
Sequence:CCGGGAATGTGTCAAGGAGAAGAATCTCGAGATTCTTCTCCTTGACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2225s1c1
Sequence:CCGGGATACCTGAAATACGAGAACACTCGAGTGTTCTCGTATTTCAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016150
ASB2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2217s1c1
Sequence:CCGGGCTGATTAGATACCTGAAATACTCGAGTATTTCAGGTATCTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2430s1c1
Sequence:CCGGGCAGAGAACAGAATGTGTCAACTCGAGTTGACACATTCTGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2064s1c1
Sequence:CCGGGAAGGAACACATCGACAGCTTCTCGAGAAGCTGTCGATGTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-615s1c1
Sequence:CCGGGCAGAAATACAGCAGCAGCTTCTCGAGAAGCTGCTGCTGTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2281s1c1
Sequence:CCGGCCCTCAGACTCTTCTTACTAACTCGAGTTAGTAAGAAGAGTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2440s1c1
Sequence:CCGGGAATGTGTCAAGGAGAAGAATCTCGAGATTCTTCTCCTTGACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2225s1c1
Sequence:CCGGGATACCTGAAATACGAGAACACTCGAGTGTTCTCGTATTTCAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016150
ASB2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2217s1c1
Sequence:CCGGGCTGATTAGATACCTGAAATACTCGAGTATTTCAGGTATCTAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2430s1c1
Sequence:CCGGGCAGAGAACAGAATGTGTCAACTCGAGTTGACACATTCTGTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2064s1c1
Sequence:CCGGGAAGGAACACATCGACAGCTTCTCGAGAAGCTGTCGATGTGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-615s1c1
Sequence:CCGGGCAGAAATACAGCAGCAGCTTCTCGAGAAGCTGCTGCTGTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2281s1c1
Sequence:CCGGCCCTCAGACTCTTCTTACTAACTCGAGTTAGTAAGAAGAGTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016150.3-2440s1c1
Sequence:CCGGGAATGTGTCAAGGAGAAGAATCTCGAGATTCTTCTCCTTGACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016150.3-2225s1c1
Sequence:CCGGGATACCTGAAATACGAGAACACTCGAGTGTTCTCGTATTTCAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks