EMAIL THIS PAGE TO A FRIEND

ASB3

ankyrin repeat and SOCS box containing 3

93 Gene Product Result for
Synonyms: ASB-3
Gene ID:
Human(51130) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2011]
Mouse(65257) ankyrin repeat and SOCS box-containing 3
Rat(364227) ankyrin repeat and SOCS box-containing 3
Zebrafish(334210) ankyrin repeat and SOCS box-containing 3
dog(474592) ankyrin repeat and SOCS box containing 3
domestic cat(101095095) ankyrin repeat and SOCS box containing 3
cow(540802) ankyrin repeat and SOCS box containing 3
Horse(100052747) ankyrin repeat and SOCS box containing 3
chicken(428545) ankyrin repeat and SOCS box-containing 3
naked mole-rat(101716719) ankyrin repeat and SOCS box containing 3
domestic guinea pig(100716868) ankyrin repeat and SOCS box containing 3
sheep(101103551) ankyrin repeat and SOCS box containing 3
Domestic Rabbit(100340734) ankyrin repeat and SOCS box containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016115 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016115 Rosetta Predictions human pricing
NM_145863 Rosetta Predictions human pricing
NM_001108864 Rosetta Predictions rat pricing
NM_023906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050374 predicted 1379
2 SASI_Hs01_00050375 predicted 1177
3 SASI_Hs01_00050376 predicted 1429
4 SASI_Hs01_00050377 predicted 557
5 SASI_Hs02_00348883 predicted 721
6 SASI_Hs02_00348884 predicted 879
7 SASI_Hs01_00050380 predicted 981
8 SASI_Hs01_00050382 predicted 1489
9 SASI_Hs01_00050383 predicted 1144
10 SASI_Hs02_00348885 predicted 1464
11 SASI_Hs01_00050378 predicted 931
12 SASI_Hs01_00050379 predicted 1617
13 SASI_Hs01_00050381 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166463 predicted 1174
2 SASI_Hs01_00166464 predicted 974
3 SASI_Hs01_00166465 predicted 1220
4 SASI_Hs01_00166466 predicted 341
5 SASI_Hs02_00365391 predicted 513
6 SASI_Hs02_00365392 predicted 674
7 SASI_Hs01_00166469 predicted 773
8 SASI_Hs01_00166471 predicted 1276
9 SASI_Hs01_00166472 predicted 932
10 SASI_Hs02_00365393 predicted 1263
11 SASI_Hs01_00166467 predicted 722
12 SASI_Hs01_00166468 predicted 1410
13 SASI_Hs01_00166470 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242835 predicted 1099
2 SASI_Rn02_00242836 predicted 1223
3 SASI_Rn02_00242837 predicted 435
4 SASI_Rn02_00242838 predicted 902
5 SASI_Rn02_00242839 predicted 935
6 SASI_Rn02_00242840 predicted 644
7 SASI_Rn02_00242841 predicted 779
8 SASI_Rn02_00242842 predicted 1297
9 SASI_Rn02_00242843 predicted 1081
10 SASI_Rn02_00242844 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103174 predicted 987
2 SASI_Mm01_00103175 predicted 659
3 SASI_Mm01_00103176 predicted 1588
4 SASI_Mm01_00103177 predicted 1307
5 SASI_Mm02_00327458 predicted 1231
6 SASI_Mm01_00103178 predicted 908
7 SASI_Mm01_00103179 predicted 968
8 SASI_Mm01_00103180 predicted 329
9 SASI_Mm01_00103181 predicted 1664
10 SASI_Mm01_00103183 predicted 1099
11 SASI_Mm01_00103182 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023906
VALIDATED
ASB3 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023906.3-1766s21c1
Sequence:CCGGCAGGTCCTTTAATTCTGTTTACTCGAGTAAACAGAATTAAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-1725s21c1
Sequence:CCGGGCAGCTAATCAGGATGGAGAACTCGAGTTCTCCATCCTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-650s21c1
Sequence:CCGGCCAGGGAAATGCTGAGACTATCTCGAGATAGTCTCAGCATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-918s21c1
Sequence:CCGGGACAATTGGCAATTACCTATTCTCGAGAATAGGTAATTGCCAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-978s21c1
Sequence:CCGGTTGTTAATACCACGTACTAACCTCGAGGTTAGTACGTGGTATTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1322s1c1
Sequence:CCGGGCTGGATTTGACCCATTGATTCTCGAGAATCAATGGGTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1702s1c1
Sequence:CCGGCAGGTCCTTTAATTCTGTTTACTCGAGTAAACAGAATTAAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023906.2-764s1c1
Sequence:CCGGCCTTTGTTTATTGCTGCACAACTCGAGTTGTGCAGCAATAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1661s1c1
Sequence:CCGGGCAGCTAATCAGGATGGAGAACTCGAGTTCTCCATCCTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-586s1c1
Sequence:CCGGCCAGGGAAATGCTGAGACTATCTCGAGATAGTCTCAGCATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023906
VALIDATED
ASB3 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023906.3-1766s21c1
Sequence:CCGGCAGGTCCTTTAATTCTGTTTACTCGAGTAAACAGAATTAAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-1725s21c1
Sequence:CCGGGCAGCTAATCAGGATGGAGAACTCGAGTTCTCCATCCTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-650s21c1
Sequence:CCGGCCAGGGAAATGCTGAGACTATCTCGAGATAGTCTCAGCATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-918s21c1
Sequence:CCGGGACAATTGGCAATTACCTATTCTCGAGAATAGGTAATTGCCAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-978s21c1
Sequence:CCGGTTGTTAATACCACGTACTAACCTCGAGGTTAGTACGTGGTATTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1322s1c1
Sequence:CCGGGCTGGATTTGACCCATTGATTCTCGAGAATCAATGGGTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1702s1c1
Sequence:CCGGCAGGTCCTTTAATTCTGTTTACTCGAGTAAACAGAATTAAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023906.2-764s1c1
Sequence:CCGGCCTTTGTTTATTGCTGCACAACTCGAGTTGTGCAGCAATAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1661s1c1
Sequence:CCGGGCAGCTAATCAGGATGGAGAACTCGAGTTCTCCATCCTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-586s1c1
Sequence:CCGGCCAGGGAAATGCTGAGACTATCTCGAGATAGTCTCAGCATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023906
VALIDATED
ASB3 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023906.3-1766s21c1
Sequence:CCGGCAGGTCCTTTAATTCTGTTTACTCGAGTAAACAGAATTAAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-1725s21c1
Sequence:CCGGGCAGCTAATCAGGATGGAGAACTCGAGTTCTCCATCCTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-650s21c1
Sequence:CCGGCCAGGGAAATGCTGAGACTATCTCGAGATAGTCTCAGCATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-918s21c1
Sequence:CCGGGACAATTGGCAATTACCTATTCTCGAGAATAGGTAATTGCCAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023906.3-978s21c1
Sequence:CCGGTTGTTAATACCACGTACTAACCTCGAGGTTAGTACGTGGTATTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1322s1c1
Sequence:CCGGGCTGGATTTGACCCATTGATTCTCGAGAATCAATGGGTCAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1702s1c1
Sequence:CCGGCAGGTCCTTTAATTCTGTTTACTCGAGTAAACAGAATTAAAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023906.2-764s1c1
Sequence:CCGGCCTTTGTTTATTGCTGCACAACTCGAGTTGTGCAGCAATAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-1661s1c1
Sequence:CCGGGCAGCTAATCAGGATGGAGAACTCGAGTTCTCCATCCTGATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023906.2-586s1c1
Sequence:CCGGCCAGGGAAATGCTGAGACTATCTCGAGATAGTCTCAGCATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016115
VALIDATED
ASB3 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016115.3-981s1c1
Sequence:CCGGCCCTGTTTACTCAGCAGTGTTCTCGAGAACACTGCTGAGTAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016115.3-1336s1c1
Sequence:CCGGGCTGGATTTGACCCACTGATTCTCGAGAATCAGTGGGTCAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016115.3-448s1c1
Sequence:CCGGCCTAATGCAACTACTTTAGAACTCGAGTTCTAAAGTAGTTGCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016115.3-193s1c1
Sequence:CCGGGAAGGCAATGTTAAAGTCTTACTCGAGTAAGACTTTAACATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016115.3-1021s1c1
Sequence:CCGGCTAGAAATATTACTCCGGAATCTCGAGATTCCGGAGTAATATTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016115.3-286s1c1
Sequence:CCGGGCTTATCACAACTCTGTAGAACTCGAGTTCTACAGAGTTGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016115.3-1699s1c1
Sequence:CCGGGAAACTACTTAACACAGCTAACTCGAGTTAGCTGTGTTAAGTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016115.3-283s1c1
Sequence:CCGGGCAGCTTATCACAACTCTGTACTCGAGTACAGAGTTGTGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016115.3-1931s1c1
Sequence:CCGGGCAGCTTCATCACCAGTACATCTCGAGATGTACTGGTGATGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016115
VALIDATED
ASB3 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016115.3-981s1c1
Sequence:CCGGCCCTGTTTACTCAGCAGTGTTCTCGAGAACACTGCTGAGTAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016115.3-1336s1c1
Sequence:CCGGGCTGGATTTGACCCACTGATTCTCGAGAATCAGTGGGTCAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016115.3-448s1c1
Sequence:CCGGCCTAATGCAACTACTTTAGAACTCGAGTTCTAAAGTAGTTGCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016115.3-193s1c1
Sequence:CCGGGAAGGCAATGTTAAAGTCTTACTCGAGTAAGACTTTAACATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016115.3-1021s1c1
Sequence:CCGGCTAGAAATATTACTCCGGAATCTCGAGATTCCGGAGTAATATTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016115.3-286s1c1
Sequence:CCGGGCTTATCACAACTCTGTAGAACTCGAGTTCTACAGAGTTGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016115.3-1699s1c1
Sequence:CCGGGAAACTACTTAACACAGCTAACTCGAGTTAGCTGTGTTAAGTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016115.3-283s1c1
Sequence:CCGGGCAGCTTATCACAACTCTGTACTCGAGTACAGAGTTGTGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016115.3-1931s1c1
Sequence:CCGGGCAGCTTCATCACCAGTACATCTCGAGATGTACTGGTGATGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016115
VALIDATED
ASB3 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016115.3-981s1c1
Sequence:CCGGCCCTGTTTACTCAGCAGTGTTCTCGAGAACACTGCTGAGTAAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016115.3-1336s1c1
Sequence:CCGGGCTGGATTTGACCCACTGATTCTCGAGAATCAGTGGGTCAAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016115.3-448s1c1
Sequence:CCGGCCTAATGCAACTACTTTAGAACTCGAGTTCTAAAGTAGTTGCATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016115.3-193s1c1
Sequence:CCGGGAAGGCAATGTTAAAGTCTTACTCGAGTAAGACTTTAACATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016115.3-1021s1c1
Sequence:CCGGCTAGAAATATTACTCCGGAATCTCGAGATTCCGGAGTAATATTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016115.3-286s1c1
Sequence:CCGGGCTTATCACAACTCTGTAGAACTCGAGTTCTACAGAGTTGTGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016115.3-1699s1c1
Sequence:CCGGGAAACTACTTAACACAGCTAACTCGAGTTAGCTGTGTTAAGTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016115.3-283s1c1
Sequence:CCGGGCAGCTTATCACAACTCTGTACTCGAGTACAGAGTTGTGATAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016115.3-1931s1c1
Sequence:CCGGGCAGCTTCATCACCAGTACATCTCGAGATGTACTGGTGATGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks