EMAIL THIS PAGE TO A FRIEND

ASB4

ankyrin repeat and SOCS box containing 4

58 Gene Product Result for
Synonyms: ASB-4
UniProtKB ID: Q9Y574, A4D1H6, O14586, Q14D68, Q8TBT2
Gene ID:
Human(51666) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
Mouse(65255) ankyrin repeat and SOCS box-containing 4
Rat(500017) ankyrin repeat and SOCS box-containing 4
sheep(101117496) ankyrin repeat and SOCS box containing 4
domestic guinea pig(100735020) ankyrin repeat and SOCS box containing 4
naked mole-rat(101698059) ankyrin repeat and SOCS box containing 4
Zebrafish(550321) ankyrin repeat and SOCS box-containing 4
dog(482309) ankyrin repeat and SOCS box containing 4
domestic cat(101092013) ankyrin repeat and SOCS box containing 4
cow(535831) ankyrin repeat and SOCS box containing 4
Horse(100052021) ankyrin repeat and SOCS box containing 4
chicken(420569) ankyrin repeat and SOCS box containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068701 MISSION® esiRNA esiRNA human ASB4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016116 Rosetta Predictions human pricing
NM_145872 Rosetta Predictions human pricing
NM_001024318 Rosetta Predictions rat pricing
NM_023048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096874 predicted 415
2 SASI_Hs01_00096875 predicted 395
3 SASI_Hs01_00096877 predicted 639
4 SASI_Hs01_00096878 predicted 642
5 SASI_Hs01_00096879 predicted 736
6 SASI_Hs01_00096880 predicted 348
7 SASI_Hs01_00096881 predicted 328
8 SASI_Hs02_00348886 predicted 298
9 SASI_Hs01_00096882 predicted 699
10 SASI_Hs01_00096883 predicted 345
11 SASI_Hs01_00096876 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124956 predicted 418
2 SASI_Hs01_00124957 predicted 394
3 SASI_Hs01_00124959 predicted 638
4 SASI_Hs01_00124960 predicted 644
5 SASI_Hs01_00124961 predicted 732
6 SASI_Hs01_00124962 predicted 344
7 SASI_Hs01_00124963 predicted 328
8 SASI_Hs02_00365402 predicted 301
9 SASI_Hs01_00124964 predicted 698
10 SASI_Hs01_00124965 predicted 349
11 SASI_Hs01_00124958 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045063 predicted 1272
2 SASI_Rn01_00045064 predicted 1167
3 SASI_Rn01_00045065 predicted 1200
4 SASI_Rn02_00202531 predicted 1128
5 SASI_Rn01_00045066 predicted 1097
6 SASI_Rn01_00045067 predicted 1018
7 SASI_Rn01_00045068 predicted 1000
8 SASI_Rn01_00045069 predicted 199
9 SASI_Rn01_00045070 predicted 1044
10 SASI_Rn01_00045071 predicted 667
11 SASI_Rn01_00045072 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022337 predicted 1287
2 SASI_Mm01_00022338 predicted 1188
3 SASI_Mm01_00022339 predicted 509
4 SASI_Mm01_00022340 predicted 1213
5 SASI_Mm01_00022341 predicted 1031
6 SASI_Mm02_00326745 predicted 1043
7 SASI_Mm01_00022343 predicted 1050
8 SASI_Mm01_00022344 predicted 1398
9 SASI_Mm01_00022345 predicted 689
10 SASI_Mm02_00326746 predicted 631
11 SASI_Mm01_00022336 predicted 215
12 SASI_Mm01_00022342 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016116
ASB4 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-234s1c1
Sequence:CCGGCCTCCATCTCTCTGTCTTGTTCTCGAGAACAAGACAGAGAGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-988s1c1
Sequence:CCGGGCCTGCCATTCTTGTCCTAAACTCGAGTTTAGGACAAGAATGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-1076s1c1
Sequence:CCGGCCGATGATGACTTGGAGAAATCTCGAGATTTCTCCAAGTCATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-740s1c1
Sequence:CCGGCCCGAGATGACGACTTTAAATCTCGAGATTTAAAGTCGTCATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-40s1c1
Sequence:CCGGGCCAAGTTAGTTAAGAGAAATCTCGAGATTTCTCTTAACTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016116
ASB4 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-234s1c1
Sequence:CCGGCCTCCATCTCTCTGTCTTGTTCTCGAGAACAAGACAGAGAGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-988s1c1
Sequence:CCGGGCCTGCCATTCTTGTCCTAAACTCGAGTTTAGGACAAGAATGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-1076s1c1
Sequence:CCGGCCGATGATGACTTGGAGAAATCTCGAGATTTCTCCAAGTCATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-740s1c1
Sequence:CCGGCCCGAGATGACGACTTTAAATCTCGAGATTTAAAGTCGTCATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-40s1c1
Sequence:CCGGGCCAAGTTAGTTAAGAGAAATCTCGAGATTTCTCTTAACTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016116
ASB4 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-234s1c1
Sequence:CCGGCCTCCATCTCTCTGTCTTGTTCTCGAGAACAAGACAGAGAGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-988s1c1
Sequence:CCGGGCCTGCCATTCTTGTCCTAAACTCGAGTTTAGGACAAGAATGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-1076s1c1
Sequence:CCGGCCGATGATGACTTGGAGAAATCTCGAGATTTCTCCAAGTCATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-740s1c1
Sequence:CCGGCCCGAGATGACGACTTTAAATCTCGAGATTTAAAGTCGTCATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016116.1-40s1c1
Sequence:CCGGGCCAAGTTAGTTAAGAGAAATCTCGAGATTTCTCTTAACTAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023048
VALIDATED
ASB4 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023048.4-67s1c1
Sequence:CCGGGCTGCCAAATTAGTTAAGAAACTCGAGTTTCTTAACTAATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023048.4-768s1c1
Sequence:CCGGCGCTCGTGATGATGATTTCAACTCGAGTTGAAATCATCATCACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023048.4-2192s1c1
Sequence:CCGGCCTGCTACTATTGGAGTAAATCTCGAGATTTACTCCAATAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023048.4-202s1c1
Sequence:CCGGGCATCTTACAAACAAGGCTATCTCGAGATAGCCTTGTTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023048.4-1290s1c1
Sequence:CCGGGCCAGAGGGAATCATTTACTACTCGAGTAGTAAATGATTCCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023048
VALIDATED
ASB4 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023048.4-67s1c1
Sequence:CCGGGCTGCCAAATTAGTTAAGAAACTCGAGTTTCTTAACTAATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023048.4-768s1c1
Sequence:CCGGCGCTCGTGATGATGATTTCAACTCGAGTTGAAATCATCATCACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023048.4-2192s1c1
Sequence:CCGGCCTGCTACTATTGGAGTAAATCTCGAGATTTACTCCAATAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023048.4-202s1c1
Sequence:CCGGGCATCTTACAAACAAGGCTATCTCGAGATAGCCTTGTTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023048.4-1290s1c1
Sequence:CCGGGCCAGAGGGAATCATTTACTACTCGAGTAGTAAATGATTCCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023048
VALIDATED
ASB4 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023048.4-67s1c1
Sequence:CCGGGCTGCCAAATTAGTTAAGAAACTCGAGTTTCTTAACTAATTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023048.4-768s1c1
Sequence:CCGGCGCTCGTGATGATGATTTCAACTCGAGTTGAAATCATCATCACGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023048.4-2192s1c1
Sequence:CCGGCCTGCTACTATTGGAGTAAATCTCGAGATTTACTCCAATAGTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023048.4-202s1c1
Sequence:CCGGGCATCTTACAAACAAGGCTATCTCGAGATAGCCTTGTTTGTAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023048.4-1290s1c1
Sequence:CCGGGCCAGAGGGAATCATTTACTACTCGAGTAGTAAATGATTCCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks