EMAIL THIS PAGE TO A FRIEND

ASB5

ankyrin repeat and SOCS box containing 5

49 Gene Product Result for
Synonyms: ASB-5
UniProtKB ID: Q8WWX0
Gene ID:
Human(140458) Summary: The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but their full length sequences are not known. [provided by RefSeq, Jul 2008]
Mouse(76294) ankyrin repeat and SOCs box-containing 5
Rat(361187) ankyrin repeat and SOCS box-containing 5
chicken(422572) ankyrin repeat and SOCS box containing 5
cow(516722) ankyrin repeat and SOCS box containing 5
domestic cat(101080527) ankyrin repeat and SOCS box containing 5
dog(482933) ankyrin repeat and SOCS box containing 5
naked mole-rat(101717889) ankyrin repeat and SOCS box containing 5
domestic guinea pig(100725026) ankyrin repeat and SOCS box containing 5
sheep(101108021) ankyrin repeat and SOCS box containing 5
Domestic Rabbit(100302410) ankyrin repeat and SOCS box containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080874 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080874 Rosetta Predictions human pricing
NM_001044247 Rosetta Predictions rat pricing
NM_029569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118756 predicted 834
2 SASI_Hs01_00118757 predicted 965
3 SASI_Hs02_00362671 predicted 938
4 SASI_Hs01_00118759 predicted 623
5 SASI_Hs01_00118760 predicted 539
6 SASI_Hs01_00118761 predicted 602
7 SASI_Hs01_00118762 predicted 1011
8 SASI_Hs01_00118763 predicted 892
9 SASI_Hs01_00118764 predicted 825
10 SASI_Hs01_00118765 predicted 979
11 SASI_Hs01_00118758 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205197 predicted 437
2 SASI_Rn02_00205198 predicted 692
3 SASI_Rn02_00205199 predicted 750
4 SASI_Rn02_00205200 predicted 1021
5 SASI_Rn02_00205201 predicted 728
6 SASI_Rn02_00205202 predicted 919
7 SASI_Rn02_00205203 predicted 278
8 SASI_Rn02_00205204 predicted 575
9 SASI_Rn02_00205205 predicted 217
10 SASI_Rn02_00205206 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196310 predicted 706
2 SASI_Mm01_00196311 predicted 377
3 SASI_Mm01_00196312 predicted 619
4 SASI_Mm01_00196313 predicted 715
5 SASI_Mm01_00196309 predicted 412
6 SASI_Mm01_00196314 predicted 1172
7 SASI_Mm01_00196315 predicted 1066
8 SASI_Mm01_00196317 predicted 726
9 SASI_Mm02_00335517 predicted 784
10 SASI_Mm01_00196318 predicted 903
11 SASI_Mm01_00196316 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080874
ASB5 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-689s1c1
Sequence:CCGGGCTGACGTACAGAAAGGCAAACTCGAGTTTGCCTTTCTGTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080874.2-195s1c1
Sequence:CCGGGAGTAACCCAAGGACAAGGTTCTCGAGAACCTTGTCCTTGGGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080874.2-1999s1c1
Sequence:CCGGGAGAACTTAATCGCACTGTTTCTCGAGAAACAGTGCGATTAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080874.2-2065s1c1
Sequence:CCGGGCAAGTAATAGCAAGAGAGTACTCGAGTACTCTCTTGCTATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-588s1c1
Sequence:CCGGGCATAGATGTTGACCAAGAAACTCGAGTTTCTTGGTCAACATCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080874.2-1440s1c1
Sequence:CCGGGCTTAGCAAAGAGCAACTAATCTCGAGATTAGTTGCTCTTTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080874.2-635s1c1
Sequence:CCGGGTAGCTTGTATGTCACAGCAACTCGAGTTGCTGTGACATACAAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-142s1c1
Sequence:CCGGCATAGTGAAAGGCAACCGCAACTCGAGTTGCGGTTGCCTTTCACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080874.2-1401s21c1
Sequence:CCGGGCTAACTTGTTACTGATATTGCTCGAGCAATATCAGTAACAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080874.2-419s21c1
Sequence:CCGGGATGGCGTGACTCCGTTATTCCTCGAGGAATAACGGAGTCACGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080874.2-806s21c1
Sequence:CCGGACAGAGCTTCTGCGACCTATACTCGAGTATAGGTCGCAGAAGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080874
ASB5 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-689s1c1
Sequence:CCGGGCTGACGTACAGAAAGGCAAACTCGAGTTTGCCTTTCTGTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080874.2-195s1c1
Sequence:CCGGGAGTAACCCAAGGACAAGGTTCTCGAGAACCTTGTCCTTGGGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080874.2-1999s1c1
Sequence:CCGGGAGAACTTAATCGCACTGTTTCTCGAGAAACAGTGCGATTAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080874.2-2065s1c1
Sequence:CCGGGCAAGTAATAGCAAGAGAGTACTCGAGTACTCTCTTGCTATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-588s1c1
Sequence:CCGGGCATAGATGTTGACCAAGAAACTCGAGTTTCTTGGTCAACATCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080874.2-1440s1c1
Sequence:CCGGGCTTAGCAAAGAGCAACTAATCTCGAGATTAGTTGCTCTTTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080874.2-635s1c1
Sequence:CCGGGTAGCTTGTATGTCACAGCAACTCGAGTTGCTGTGACATACAAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-142s1c1
Sequence:CCGGCATAGTGAAAGGCAACCGCAACTCGAGTTGCGGTTGCCTTTCACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080874.2-1401s21c1
Sequence:CCGGGCTAACTTGTTACTGATATTGCTCGAGCAATATCAGTAACAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080874.2-419s21c1
Sequence:CCGGGATGGCGTGACTCCGTTATTCCTCGAGGAATAACGGAGTCACGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080874.2-806s21c1
Sequence:CCGGACAGAGCTTCTGCGACCTATACTCGAGTATAGGTCGCAGAAGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080874
ASB5 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-689s1c1
Sequence:CCGGGCTGACGTACAGAAAGGCAAACTCGAGTTTGCCTTTCTGTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080874.2-195s1c1
Sequence:CCGGGAGTAACCCAAGGACAAGGTTCTCGAGAACCTTGTCCTTGGGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080874.2-1999s1c1
Sequence:CCGGGAGAACTTAATCGCACTGTTTCTCGAGAAACAGTGCGATTAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080874.2-2065s1c1
Sequence:CCGGGCAAGTAATAGCAAGAGAGTACTCGAGTACTCTCTTGCTATTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-588s1c1
Sequence:CCGGGCATAGATGTTGACCAAGAAACTCGAGTTTCTTGGTCAACATCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134768    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080874.2-1440s1c1
Sequence:CCGGGCTTAGCAAAGAGCAACTAATCTCGAGATTAGTTGCTCTTTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080874.2-635s1c1
Sequence:CCGGGTAGCTTGTATGTCACAGCAACTCGAGTTGCTGTGACATACAAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080874.2-142s1c1
Sequence:CCGGCATAGTGAAAGGCAACCGCAACTCGAGTTGCGGTTGCCTTTCACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080874.2-1401s21c1
Sequence:CCGGGCTAACTTGTTACTGATATTGCTCGAGCAATATCAGTAACAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080874.2-419s21c1
Sequence:CCGGGATGGCGTGACTCCGTTATTCCTCGAGGAATAACGGAGTCACGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080874.2-806s21c1
Sequence:CCGGACAGAGCTTCTGCGACCTATACTCGAGTATAGGTCGCAGAAGCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029569
ASB5 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029569.1-1190s1c1
Sequence:CCGGGCATATAAGTTCACCCAGCAACTCGAGTTGCTGGGTGAACTTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-932s1c1
Sequence:CCGGGCTACATCTAACAGTGCTGTACTCGAGTACAGCACTGTTAGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-500s1c1
Sequence:CCGGGCAAACGCAATCACCATAGATCTCGAGATCTATGGTGATTGCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-751s1c1
Sequence:CCGGGCAGTTCCATTGCATCTGGAACTCGAGTTCCAGATGCAATGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-376s1c1
Sequence:CCGGGACATTGCTATCACAAGGATACTCGAGTATCCTTGTGATAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029569
ASB5 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029569.1-1190s1c1
Sequence:CCGGGCATATAAGTTCACCCAGCAACTCGAGTTGCTGGGTGAACTTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-932s1c1
Sequence:CCGGGCTACATCTAACAGTGCTGTACTCGAGTACAGCACTGTTAGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-500s1c1
Sequence:CCGGGCAAACGCAATCACCATAGATCTCGAGATCTATGGTGATTGCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-751s1c1
Sequence:CCGGGCAGTTCCATTGCATCTGGAACTCGAGTTCCAGATGCAATGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-376s1c1
Sequence:CCGGGACATTGCTATCACAAGGATACTCGAGTATCCTTGTGATAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029569
ASB5 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029569.1-1190s1c1
Sequence:CCGGGCATATAAGTTCACCCAGCAACTCGAGTTGCTGGGTGAACTTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-932s1c1
Sequence:CCGGGCTACATCTAACAGTGCTGTACTCGAGTACAGCACTGTTAGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-500s1c1
Sequence:CCGGGCAAACGCAATCACCATAGATCTCGAGATCTATGGTGATTGCGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-751s1c1
Sequence:CCGGGCAGTTCCATTGCATCTGGAACTCGAGTTCCAGATGCAATGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029569.1-376s1c1
Sequence:CCGGGACATTGCTATCACAAGGATACTCGAGTATCCTTGTGATAGCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks