EMAIL THIS PAGE TO A FRIEND

ASB6

ankyrin repeat and SOCS box containing 6

143 Gene Product Result for
UniProtKB ID: Q9NWX5, Q5SZB7, Q9BV15
Gene ID:
Human(140459) Summary: The protein encoded by this gene belongs to a family of ankyrin repeat proteins that, along with four other protein families, contain a C-terminal SOCS box motif. Growing evidence suggests that the SOCS box, similar to the F-box, acts as a bridge between specific substrate-binding domains and the more generic proteins that comprise a large family of E3 ubiquitin protein ligases. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
Mouse(72323) ankyrin repeat and SOCS box-containing 6
Rat(296627) ankyrin repeat and SOCS box-containing 6
Zebrafish(553600) ankyrin repeat and SOCS box containing 6
cow(509719) ankyrin repeat and SOCS box containing 6
domestic cat(101085581) ankyrin repeat and SOCS box containing 6
dog(491299) ankyrin repeat and SOCS box containing 6
chicken(417194) ankyrin repeat and SOCS box containing 6
sheep(101104650) ankyrin repeat and SOCS box containing 6
domestic guinea pig(100733793) ankyrin repeat and SOCS box containing 6
naked mole-rat(101703589) ankyrin repeat and SOCS box containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133346 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133346 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133346 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017873 Rosetta Predictions human pricing
NM_177999 Rosetta Predictions human pricing
NM_001011963 Rosetta Predictions rat pricing
XM_578105 Rosetta Predictions rat pricing
NM_133346 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136496 predicted 1417
2 SASI_Hs01_00136497 predicted 267
3 SASI_Hs01_00136498 predicted 955
4 SASI_Hs01_00136499 predicted 1568
5 SASI_Hs01_00136500 predicted 1528
6 SASI_Hs01_00136501 predicted 1885
7 SASI_Hs01_00136503 predicted 304
8 SASI_Hs01_00136504 predicted 272
9 SASI_Hs01_00136505 predicted 1674
10 SASI_Hs02_00350813 predicted 1525
11 SASI_Hs01_00136502 predicted 1886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111378 predicted 273
2 SASI_Hs01_00111379 predicted 305
3 SASI_Hs01_00111380 predicted 1067
4 SASI_Hs01_00111381 predicted 743
5 SASI_Hs01_00111382 predicted 262
6 SASI_Hs01_00111383 predicted 844
7 SASI_Hs01_00111384 predicted 179
8 SASI_Hs01_00111385 predicted 302
9 SASI_Hs02_00369472 predicted 260
10 SASI_Hs02_00369473 predicted 945
11 SASI_Hs01_00111386 predicted 622
12 SASI_Hs01_00111387 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118244 predicted 1469
2 SASI_Rn01_00118245 predicted 1783
3 SASI_Rn01_00118246 predicted 1177
4 SASI_Rn01_00118247 predicted 1598
5 SASI_Rn01_00118248 predicted 1494
6 SASI_Rn01_00118249 predicted 1779
7 SASI_Rn01_00118250 predicted 1592
8 SASI_Rn01_00118251 predicted 1382
9 SASI_Rn01_00118253 predicted 1103
10 SASI_Rn02_00199983 predicted 1690
11 SASI_Rn01_00118252 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127591 predicted 467
2 SASI_Rn01_00127592 predicted 952
3 SASI_Rn01_00127593 predicted 1026
4 SASI_Rn01_00127594 predicted 709
5 SASI_Rn01_00127595 predicted 319
6 SASI_Rn01_00127596 predicted 788
7 SASI_Rn01_00127597 predicted 621
8 SASI_Rn01_00127598 predicted 953
9 SASI_Rn01_00127599 predicted 604
10 SASI_Rn01_00127600 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133346 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338518 predicted 566
2 SASI_Mm02_00338519 predicted 1740
3 SASI_Mm01_00038872 predicted 1413
4 SASI_Mm02_00338520 predicted 875
5 SASI_Mm01_00038873 predicted 1602
6 SASI_Mm01_00038875 predicted 1597
7 SASI_Mm02_00338521 predicted 273
8 SASI_Mm01_00038876 predicted 1343
9 SASI_Mm02_00338522 predicted 1310
10 SASI_Mm02_00338523 predicted 1323
11 SASI_Mm01_00038874 predicted 3452
12 SASI_Mm01_00038877 predicted 2472
13 SASI_Mm01_00038878 predicted 3456
14 SASI_Mm01_00038879 predicted 3102
15 SASI_Mm01_00038880 predicted 3790
16 SASI_Mm01_00038881 predicted 2638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133346
VALIDATED
ASB6 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-741s21c1
Sequence:CCGGCACTGTATTCACCTGCATCATCTCGAGATGATGCAGGTGAATACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-1062s21c1
Sequence:CCGGCCACATTGAGCTTCTGCATAACTCGAGTTATGCAGAAGCTCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133346.2-1476s21c1
Sequence:CCGGCCTGCCCTTTACTGCTATGAACTCGAGTTCATAGCAGTAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-393s21c1
Sequence:CCGGCAATTTCGAAGACCCTGTTACCTCGAGGTAACAGGGTCTTCGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-429s21c1
Sequence:CCGGGCACATTGCTGTCCTGAGAAACTCGAGTTTCTCAGGACAGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-280s21c1
Sequence:CCGGCAGAAGGCTCACTCTCCATTCCTCGAGGAATGGAGAGTGAGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-3514s1c1
Sequence:CCGGCCTGCCCTTTACTGCTATGAACTCGAGTTCATAGCAGTAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133346.1-3384s1c1
Sequence:CCGGACAGTGATACCCAAGACACTTCTCGAGAAGTGTCTTGGGTATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-2350s1c1
Sequence:CCGGCGTGAGCAATGCGTTGCTGAACTCGAGTTCAGCAACGCATTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-3100s1c1
Sequence:CCGGCCACATTGAGCTTCTGCATAACTCGAGTTATGCAGAAGCTCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-2467s1c1
Sequence:CCGGGCACATTGCTGTCCTGAGAAACTCGAGTTTCTCAGGACAGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133346
VALIDATED
ASB6 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-741s21c1
Sequence:CCGGCACTGTATTCACCTGCATCATCTCGAGATGATGCAGGTGAATACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-1062s21c1
Sequence:CCGGCCACATTGAGCTTCTGCATAACTCGAGTTATGCAGAAGCTCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133346.2-1476s21c1
Sequence:CCGGCCTGCCCTTTACTGCTATGAACTCGAGTTCATAGCAGTAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-393s21c1
Sequence:CCGGCAATTTCGAAGACCCTGTTACCTCGAGGTAACAGGGTCTTCGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-429s21c1
Sequence:CCGGGCACATTGCTGTCCTGAGAAACTCGAGTTTCTCAGGACAGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-280s21c1
Sequence:CCGGCAGAAGGCTCACTCTCCATTCCTCGAGGAATGGAGAGTGAGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-3514s1c1
Sequence:CCGGCCTGCCCTTTACTGCTATGAACTCGAGTTCATAGCAGTAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133346.1-3384s1c1
Sequence:CCGGACAGTGATACCCAAGACACTTCTCGAGAAGTGTCTTGGGTATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-2350s1c1
Sequence:CCGGCGTGAGCAATGCGTTGCTGAACTCGAGTTCAGCAACGCATTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-3100s1c1
Sequence:CCGGCCACATTGAGCTTCTGCATAACTCGAGTTATGCAGAAGCTCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-2467s1c1
Sequence:CCGGGCACATTGCTGTCCTGAGAAACTCGAGTTTCTCAGGACAGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133346
VALIDATED
ASB6 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-741s21c1
Sequence:CCGGCACTGTATTCACCTGCATCATCTCGAGATGATGCAGGTGAATACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-1062s21c1
Sequence:CCGGCCACATTGAGCTTCTGCATAACTCGAGTTATGCAGAAGCTCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133346.2-1476s21c1
Sequence:CCGGCCTGCCCTTTACTGCTATGAACTCGAGTTCATAGCAGTAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-393s21c1
Sequence:CCGGCAATTTCGAAGACCCTGTTACCTCGAGGTAACAGGGTCTTCGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-429s21c1
Sequence:CCGGGCACATTGCTGTCCTGAGAAACTCGAGTTTCTCAGGACAGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133346.2-280s21c1
Sequence:CCGGCAGAAGGCTCACTCTCCATTCCTCGAGGAATGGAGAGTGAGCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-3514s1c1
Sequence:CCGGCCTGCCCTTTACTGCTATGAACTCGAGTTCATAGCAGTAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133346.1-3384s1c1
Sequence:CCGGACAGTGATACCCAAGACACTTCTCGAGAAGTGTCTTGGGTATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-2350s1c1
Sequence:CCGGCGTGAGCAATGCGTTGCTGAACTCGAGTTCAGCAACGCATTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-3100s1c1
Sequence:CCGGCCACATTGAGCTTCTGCATAACTCGAGTTATGCAGAAGCTCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133346.1-2467s1c1
Sequence:CCGGGCACATTGCTGTCCTGAGAAACTCGAGTTTCTCAGGACAGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017873
ASB6 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-799s1c1
Sequence:CCGGCACAGTGTTCACCTGCATCATCTCGAGATGATGCAGGTGAACACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-724s1c1
Sequence:CCGGGATCCACAATACTGAGAACATCTCGAGATGTTCTCAGTATTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017873.2-2324s1c1
Sequence:CCGGGCCTTAACAAGGTCCTTATATCTCGAGATATAAGGACCTTGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-967s1c1
Sequence:CCGGGAAGAGCTTTAAACTGCACTTCTCGAGAAGTGCAGTTTAAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-721s1c1
Sequence:CCGGGCAGATCCACAATACTGAGAACTCGAGTTCTCAGTATTGTGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-865s1c1
Sequence:CCGGGATGATCAACCGCTTCTGCTTCTCGAGAAGCAGAAGCGGTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-1168s1c1
Sequence:CCGGGACCAACTCTCAGAAACTCCACTCGAGTGGAGTTTCTGAGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017873.2-2761s1c1
Sequence:CCGGGCCTTTCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-1162s1c1
Sequence:CCGGCATGGTGACCAACTCTCAGAACTCGAGTTCTGAGAGTTGGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-454s1c1
Sequence:CCGGCTTTGAAGACCCAGTCACCTACTCGAGTAGGTGACTGGGTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017873
ASB6 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-799s1c1
Sequence:CCGGCACAGTGTTCACCTGCATCATCTCGAGATGATGCAGGTGAACACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-724s1c1
Sequence:CCGGGATCCACAATACTGAGAACATCTCGAGATGTTCTCAGTATTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017873.2-2324s1c1
Sequence:CCGGGCCTTAACAAGGTCCTTATATCTCGAGATATAAGGACCTTGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-967s1c1
Sequence:CCGGGAAGAGCTTTAAACTGCACTTCTCGAGAAGTGCAGTTTAAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-721s1c1
Sequence:CCGGGCAGATCCACAATACTGAGAACTCGAGTTCTCAGTATTGTGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-865s1c1
Sequence:CCGGGATGATCAACCGCTTCTGCTTCTCGAGAAGCAGAAGCGGTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-1168s1c1
Sequence:CCGGGACCAACTCTCAGAAACTCCACTCGAGTGGAGTTTCTGAGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017873.2-2761s1c1
Sequence:CCGGGCCTTTCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-1162s1c1
Sequence:CCGGCATGGTGACCAACTCTCAGAACTCGAGTTCTGAGAGTTGGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-454s1c1
Sequence:CCGGCTTTGAAGACCCAGTCACCTACTCGAGTAGGTGACTGGGTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017873
ASB6 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-799s1c1
Sequence:CCGGCACAGTGTTCACCTGCATCATCTCGAGATGATGCAGGTGAACACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-724s1c1
Sequence:CCGGGATCCACAATACTGAGAACATCTCGAGATGTTCTCAGTATTGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017873.2-2324s1c1
Sequence:CCGGGCCTTAACAAGGTCCTTATATCTCGAGATATAAGGACCTTGTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-967s1c1
Sequence:CCGGGAAGAGCTTTAAACTGCACTTCTCGAGAAGTGCAGTTTAAAGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-721s1c1
Sequence:CCGGGCAGATCCACAATACTGAGAACTCGAGTTCTCAGTATTGTGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-865s1c1
Sequence:CCGGGATGATCAACCGCTTCTGCTTCTCGAGAAGCAGAAGCGGTTGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017873.2-1168s1c1
Sequence:CCGGGACCAACTCTCAGAAACTCCACTCGAGTGGAGTTTCTGAGAGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017873.2-2761s1c1
Sequence:CCGGGCCTTTCAAAGTGCTGGGATTCTCGAGAATCCCAGCACTTTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-1162s1c1
Sequence:CCGGCATGGTGACCAACTCTCAGAACTCGAGTTCTGAGAGTTGGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017873.2-454s1c1
Sequence:CCGGCTTTGAAGACCCAGTCACCTACTCGAGTAGGTGACTGGGTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks