EMAIL THIS PAGE TO A FRIEND

ASB7

ankyrin repeat and SOCS box containing 7

175 Gene Product Result for
UniProtKB ID: Q9H672, A8K1E5, Q6GSJ6, Q7Z4S3
Gene ID:
Human(140460) Summary: The protein encoded by this gene belongs to a family of ankyrin repeat proteins that, along with four other protein families, contains a C-terminal SOCS box motif. Growing evidence suggests that the SOCS box acts as a bridge between specific substrate-binding domains and the more generic proteins that comprise a large family of E3 ubiquitin protein ligases. In this way, SOCS box containing proteins may regulate protein turnover by targeting proteins for polyubiquination and, therefore, for proteasome-mediated degradation. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(117589) ankyrin repeat and SOCS box-containing 7
Rat(365277) ankyrin repeat and SOCS box-containing 7
naked mole-rat(101701640) ankyrin repeat and SOCS box containing 7
domestic guinea pig(100713127) ankyrin repeat and SOCS box containing 7
sheep(101115908) ankyrin repeat and SOCS box containing 7
Domestic Rabbit(100359252) ankyrin repeat and SOCS box containing 7
Zebrafish(405798) ankyrin repeat and SOCS box-containing 7
cow(507483) ankyrin repeat and SOCS box containing 7
Horse(100050201) ankyrin repeat and SOCS box containing 7
chicken(415518) ankyrin repeat and SOCS box containing 7
dog(488707) ankyrin repeat and SOCS box containing 7
domestic cat(101099556) ankyrin repeat and SOCS box containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024708 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063991 MISSION® esiRNA esiRNA human ASB7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024708 Rosetta Predictions human pricing
NM_198243 Rosetta Predictions human pricing
NM_001108915 Rosetta Predictions rat pricing
NM_080443 Rosetta Predictions mouse pricing
NM_178236 Rosetta Predictions mouse pricing
NR_003961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040687 predicted 1240
2 SASI_Hs01_00040688 predicted 928
3 SASI_Hs02_00357166 predicted 1152
4 SASI_Hs02_00357167 predicted 978
5 SASI_Hs01_00040689 predicted 924
6 SASI_Hs01_00040690 predicted 1119
7 SASI_Hs01_00040693 predicted 968
8 SASI_Hs01_00040694 predicted 1207
9 SASI_Hs01_00040695 predicted 1109
10 SASI_Hs01_00040696 predicted 896
11 SASI_Hs01_00040691 predicted 1144
12 SASI_Hs01_00040692 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088654 predicted 1236
2 SASI_Hs01_00088655 predicted 920
3 SASI_Hs02_00371779 predicted 1151
4 SASI_Hs02_00371780 predicted 977
5 SASI_Hs01_00088656 predicted 928
6 SASI_Hs01_00088657 predicted 1116
7 SASI_Hs01_00088660 predicted 964
8 SASI_Hs01_00088661 predicted 1213
9 SASI_Hs01_00088662 predicted 1115
10 SASI_Hs01_00088663 predicted 894
11 SASI_Hs01_00088658 predicted 1142
12 SASI_Hs01_00088659 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243344 predicted 1396
2 SASI_Rn02_00243345 predicted 1424
3 SASI_Rn02_00243346 predicted 1160
4 SASI_Rn02_00243347 predicted 916
5 SASI_Rn02_00243348 predicted 997
6 SASI_Rn02_00243349 predicted 1494
7 SASI_Rn02_00243350 predicted 951
8 SASI_Rn02_00243351 predicted 1080
9 SASI_Rn02_00243352 predicted 848
10 SASI_Rn02_00243353 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162307 predicted 1395
2 SASI_Mm01_00162300 predicted 940
3 SASI_Mm01_00162301 predicted 1006
4 SASI_Mm01_00162302 predicted 997
5 SASI_Mm01_00162303 predicted 1329
6 SASI_Mm01_00162305 predicted 1135
7 SASI_Mm01_00162306 predicted 1025
8 SASI_Mm02_00338099 predicted 1448
9 SASI_Mm02_00338100 predicted 1202
10 SASI_Mm01_00162308 predicted 1081
11 SASI_Mm01_00162304 predicted 483
12 SASI_Mm01_00162309 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139337 predicted 1305
2 SASI_Mm01_00139338 predicted 1054
3 SASI_Mm01_00139339 predicted 1348
4 SASI_Mm01_00139340 predicted 1124
5 SASI_Mm01_00139341 predicted 1007
6 SASI_Mm01_00139342 predicted 886
7 SASI_Mm01_00139343 predicted 1410
8 SASI_Mm01_00139344 predicted 1089
9 SASI_Mm01_00139345 predicted 850
10 SASI_Mm01_00139346 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353956 predicted 3210
2 SASI_Mm02_00353957 predicted 1495
3 SASI_Mm02_00353958 predicted 2867
4 SASI_Mm02_00353959 predicted 3294
5 SASI_Mm02_00353960 predicted 3793
6 SASI_Mm02_00353961 predicted 590
7 SASI_Mm02_00353962 predicted 3113
8 SASI_Mm02_00353963 predicted 3326
9 SASI_Mm02_00353964 predicted 551
10 SASI_Mm02_00353965 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080443
VALIDATED
ASB7 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080443.1-434s1c1
Sequence:CCGGCGCTCAGTGATAAAGGTACAACTCGAGTTGTACCTTTATCACTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080443.1-613s1c1
Sequence:CCGGGACACAAACTTAGGGCGTCTACTCGAGTAGACGCCCTAAGTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080443.1-761s1c1
Sequence:CCGGCCATAAGTATTTCAGGAAGTACTCGAGTACTTCCTGAAATACTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1898s21c1
Sequence:CCGGCCCACGCTTGAAGGTCTTAATCTCGAGATTAAGACCTTCAAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-930s21c1
Sequence:CCGGATCCCACGGTTAAGGATTTAACTCGAGTTAAATCCTTAACCGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1630s21c1
Sequence:CCGGGGTCATGAAAGACTACTTAAACTCGAGTTTAAGTAGTCTTTCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080443.2-1685s1c1
Sequence:CCGGGTGGACAAGATTACGAGTTATCTCGAGATAACTCGTAATCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1404s21c1
Sequence:CCGGCACGGATGCTGTATAACTATGCTCGAGCATAGTTATACAGCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080443.2-1550s21c1
Sequence:CCGGCAGGACCTGTGCCGAATTAAACTCGAGTTTAATTCGGCACAGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080443
VALIDATED
ASB7 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080443.1-434s1c1
Sequence:CCGGCGCTCAGTGATAAAGGTACAACTCGAGTTGTACCTTTATCACTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080443.1-613s1c1
Sequence:CCGGGACACAAACTTAGGGCGTCTACTCGAGTAGACGCCCTAAGTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080443.1-761s1c1
Sequence:CCGGCCATAAGTATTTCAGGAAGTACTCGAGTACTTCCTGAAATACTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1898s21c1
Sequence:CCGGCCCACGCTTGAAGGTCTTAATCTCGAGATTAAGACCTTCAAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-930s21c1
Sequence:CCGGATCCCACGGTTAAGGATTTAACTCGAGTTAAATCCTTAACCGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1630s21c1
Sequence:CCGGGGTCATGAAAGACTACTTAAACTCGAGTTTAAGTAGTCTTTCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080443.2-1685s1c1
Sequence:CCGGGTGGACAAGATTACGAGTTATCTCGAGATAACTCGTAATCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1404s21c1
Sequence:CCGGCACGGATGCTGTATAACTATGCTCGAGCATAGTTATACAGCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080443.2-1550s21c1
Sequence:CCGGCAGGACCTGTGCCGAATTAAACTCGAGTTTAATTCGGCACAGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080443
VALIDATED
ASB7 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_080443.1-434s1c1
Sequence:CCGGCGCTCAGTGATAAAGGTACAACTCGAGTTGTACCTTTATCACTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080443.1-613s1c1
Sequence:CCGGGACACAAACTTAGGGCGTCTACTCGAGTAGACGCCCTAAGTTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080443.1-761s1c1
Sequence:CCGGCCATAAGTATTTCAGGAAGTACTCGAGTACTTCCTGAAATACTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1898s21c1
Sequence:CCGGCCCACGCTTGAAGGTCTTAATCTCGAGATTAAGACCTTCAAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-930s21c1
Sequence:CCGGATCCCACGGTTAAGGATTTAACTCGAGTTAAATCCTTAACCGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1630s21c1
Sequence:CCGGGGTCATGAAAGACTACTTAAACTCGAGTTTAAGTAGTCTTTCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217732    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080443.2-1685s1c1
Sequence:CCGGGTGGACAAGATTACGAGTTATCTCGAGATAACTCGTAATCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080443.2-1404s21c1
Sequence:CCGGCACGGATGCTGTATAACTATGCTCGAGCATAGTTATACAGCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080443.2-1550s21c1
Sequence:CCGGCAGGACCTGTGCCGAATTAAACTCGAGTTTAATTCGGCACAGGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024708
VALIDATED
ASB7 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1261s1c1
Sequence:CCGGGCAATCACTCTTATTGCCGAACTCGAGTTCGGCAATAAGAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024708.2-1209s1c1
Sequence:CCGGGCCAACATCGACATTCAGAATCTCGAGATTCTGAATGTCGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1473s1c1
Sequence:CCGGCGACCATGTTTGGATTTCTTACTCGAGTAAGAAATCCAAACATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024708.2-1330s1c1
Sequence:CCGGGACAGACTCCTTTACACTTATCTCGAGATAAGTGTAAAGGAGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1380s1c1
Sequence:CCGGCGGATGTTATATAATTACGGACTCGAGTCCGTAATTATATAACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024708
VALIDATED
ASB7 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1261s1c1
Sequence:CCGGGCAATCACTCTTATTGCCGAACTCGAGTTCGGCAATAAGAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024708.2-1209s1c1
Sequence:CCGGGCCAACATCGACATTCAGAATCTCGAGATTCTGAATGTCGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1473s1c1
Sequence:CCGGCGACCATGTTTGGATTTCTTACTCGAGTAAGAAATCCAAACATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024708.2-1330s1c1
Sequence:CCGGGACAGACTCCTTTACACTTATCTCGAGATAAGTGTAAAGGAGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1380s1c1
Sequence:CCGGCGGATGTTATATAATTACGGACTCGAGTCCGTAATTATATAACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024708
VALIDATED
ASB7 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1261s1c1
Sequence:CCGGGCAATCACTCTTATTGCCGAACTCGAGTTCGGCAATAAGAGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_024708.2-1209s1c1
Sequence:CCGGGCCAACATCGACATTCAGAATCTCGAGATTCTGAATGTCGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1473s1c1
Sequence:CCGGCGACCATGTTTGGATTTCTTACTCGAGTAAGAAATCCAAACATGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024708.2-1330s1c1
Sequence:CCGGGACAGACTCCTTTACACTTATCTCGAGATAAGTGTAAAGGAGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024708.2-1380s1c1
Sequence:CCGGCGGATGTTATATAATTACGGACTCGAGTCCGTAATTATATAACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks