EMAIL THIS PAGE TO A FRIEND

ASB8

ankyrin repeat and SOCS box containing 8

80 Gene Product Result for
UniProtKB ID: Q9H765, A8K1P2, Q547Q2
Gene ID:
Mouse(78541) ankyrin repeat and SOCS box-containing 8
Rat(315287) ankyrin repeat and SOCS box-containing 8
Zebrafish(327200) ankyrin repeat and SOCS box-containing 8
cow(617269) ankyrin repeat and SOCS box containing 8
domestic cat(101089277) ankyrin repeat and SOCS box containing 8
chicken(426183) ankyrin repeat and SOCS box containing 8
dog(486587) ankyrin repeat and SOCS box containing 8
sheep(101108118) ankyrin repeat and SOCS box containing 8
domestic guinea pig(100733343) ankyrin repeat and SOCS box containing 8
naked mole-rat(101704300) ankyrin repeat and SOCS box containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040401 MISSION® esiRNA esiRNA human ASB8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024095 Rosetta Predictions human pricing
NM_001108109 Rosetta Predictions rat pricing
NM_030121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356574 predicted 544
2 SASI_Hs01_00057799 predicted 465
3 SASI_Hs01_00057800 predicted 766
4 SASI_Hs01_00057801 predicted 600
5 SASI_Hs01_00057802 predicted 362
6 SASI_Hs01_00057803 predicted 803
7 SASI_Hs01_00057805 predicted 523
8 SASI_Hs01_00057806 predicted 472
9 SASI_Hs01_00057807 predicted 404
10 SASI_Hs01_00057808 predicted 192
11 SASI_Hs01_00057804 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235444 predicted 978
2 SASI_Rn02_00235445 predicted 1233
3 SASI_Rn02_00235446 predicted 1072
4 SASI_Rn02_00235447 predicted 1247
5 SASI_Rn02_00235448 predicted 854
6 SASI_Rn02_00235449 predicted 388
7 SASI_Rn02_00235450 predicted 449
8 SASI_Rn02_00235451 predicted 1202
9 SASI_Rn02_00235452 predicted 611
10 SASI_Rn02_00235453 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161212 predicted 437
2 SASI_Mm01_00161213 predicted 721
3 SASI_Mm01_00161214 predicted 1325
4 SASI_Mm01_00161215 predicted 1221
5 SASI_Mm01_00161216 predicted 443
6 SASI_Mm01_00161217 predicted 1130
7 SASI_Mm01_00161218 predicted 1116
8 SASI_Mm01_00161219 predicted 1412
9 SASI_Mm01_00161220 predicted 1210
10 SASI_Mm01_00161221 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024095
VALIDATED
ASB8 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-609s21c1
Sequence:CCGGTGGATTACAACAATGATACACCTCGAGGTGTATCATTGTTGTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-540s21c1
Sequence:CCGGGGGCAGCCTTTAAGAACAATGCTCGAGCATTGTTCTTAAAGGCTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-463s21c1
Sequence:CCGGGGCTTGTGTGGAGGTCCTATTCTCGAGAATAGGACCTCCACACAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-217s21c1
Sequence:CCGGCTCTCTCTCCGAGCGCTTAATCTCGAGATTAAGCGCTCGGAGAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-2021s1c1
Sequence:CCGGGCTCTGAAATAACAGTCCTAACTCGAGTTAGGACTGTTATTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-2378s1c1
Sequence:CCGGGCTTTAGTGAACGATACTCTTCTCGAGAAGAGTATCGTTCACTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-698s1c1
Sequence:CCGGGTCAGAGTCATCAACCTAATACTCGAGTATTAGGTTGATGACTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-365s1c1
Sequence:CCGGGCTGACTGTGTGGAGTTACTTCTCGAGAAGTAACTCCACACAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024095.3-2091s1c1
Sequence:CCGGCCTGAGAAACAGTGTGTTCTACTCGAGTAGAACACACTGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024095
VALIDATED
ASB8 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-609s21c1
Sequence:CCGGTGGATTACAACAATGATACACCTCGAGGTGTATCATTGTTGTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-540s21c1
Sequence:CCGGGGGCAGCCTTTAAGAACAATGCTCGAGCATTGTTCTTAAAGGCTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-463s21c1
Sequence:CCGGGGCTTGTGTGGAGGTCCTATTCTCGAGAATAGGACCTCCACACAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-217s21c1
Sequence:CCGGCTCTCTCTCCGAGCGCTTAATCTCGAGATTAAGCGCTCGGAGAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-2021s1c1
Sequence:CCGGGCTCTGAAATAACAGTCCTAACTCGAGTTAGGACTGTTATTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-2378s1c1
Sequence:CCGGGCTTTAGTGAACGATACTCTTCTCGAGAAGAGTATCGTTCACTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-698s1c1
Sequence:CCGGGTCAGAGTCATCAACCTAATACTCGAGTATTAGGTTGATGACTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-365s1c1
Sequence:CCGGGCTGACTGTGTGGAGTTACTTCTCGAGAAGTAACTCCACACAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024095.3-2091s1c1
Sequence:CCGGCCTGAGAAACAGTGTGTTCTACTCGAGTAGAACACACTGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024095
VALIDATED
ASB8 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-609s21c1
Sequence:CCGGTGGATTACAACAATGATACACCTCGAGGTGTATCATTGTTGTAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-540s21c1
Sequence:CCGGGGGCAGCCTTTAAGAACAATGCTCGAGCATTGTTCTTAAAGGCTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-463s21c1
Sequence:CCGGGGCTTGTGTGGAGGTCCTATTCTCGAGAATAGGACCTCCACACAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024095.3-217s21c1
Sequence:CCGGCTCTCTCTCCGAGCGCTTAATCTCGAGATTAAGCGCTCGGAGAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-2021s1c1
Sequence:CCGGGCTCTGAAATAACAGTCCTAACTCGAGTTAGGACTGTTATTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-2378s1c1
Sequence:CCGGGCTTTAGTGAACGATACTCTTCTCGAGAAGAGTATCGTTCACTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-698s1c1
Sequence:CCGGGTCAGAGTCATCAACCTAATACTCGAGTATTAGGTTGATGACTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024095.3-365s1c1
Sequence:CCGGGCTGACTGTGTGGAGTTACTTCTCGAGAAGTAACTCCACACAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024095.3-2091s1c1
Sequence:CCGGCCTGAGAAACAGTGTGTTCTACTCGAGTAGAACACACTGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030121
VALIDATED
ASB8 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-575s21c1
Sequence:GTACCGGTCAGCATCCTTCTTGATTATGCTCGAGCATAATCAAGAAGGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030121.3-602s21c1
Sequence:GTACCGGAGGTCAGAGTCATCAACTTAACTCGAGTTAAGTTGATGACTCTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-1133s21c1
Sequence:CCGGCTCACTTGTTTGCCGTGTTATCTCGAGATAACACGGCAAACAAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-808s21c1
Sequence:CCGGTCAGCACCAGGGACGCTTAAACTCGAGTTTAAGCGTCCCTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-716s21c1
Sequence:CCGGCTGTTGGACAGTTTGAATTAACTCGAGTTAATTCAAACTGTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-1133s1c1
Sequence:CCGGCCTCACTTGTTTGCCGTGTTACTCGAGTAACACGGCAAACAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-714s1c1
Sequence:CCGGGAGCTGTTGGACAGTTTGAATCTCGAGATTCAAACTGTCCAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030121.2-548s1c1
Sequence:CCGGGCTGCCATGAAGGGAAATCTTCTCGAGAAGATTTCCCTTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-575s1c1
Sequence:CCGGGTCAGCATCCTTCTTGATTATCTCGAGATAATCAAGAAGGATGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030121.2-512s1c1
Sequence:CCGGGCCCTGGATTACAACAACGATCTCGAGATCGTTGTTGTAATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030121
VALIDATED
ASB8 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-575s21c1
Sequence:GTACCGGTCAGCATCCTTCTTGATTATGCTCGAGCATAATCAAGAAGGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030121.3-602s21c1
Sequence:GTACCGGAGGTCAGAGTCATCAACTTAACTCGAGTTAAGTTGATGACTCTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-1133s21c1
Sequence:CCGGCTCACTTGTTTGCCGTGTTATCTCGAGATAACACGGCAAACAAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-808s21c1
Sequence:CCGGTCAGCACCAGGGACGCTTAAACTCGAGTTTAAGCGTCCCTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-716s21c1
Sequence:CCGGCTGTTGGACAGTTTGAATTAACTCGAGTTAATTCAAACTGTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-1133s1c1
Sequence:CCGGCCTCACTTGTTTGCCGTGTTACTCGAGTAACACGGCAAACAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-714s1c1
Sequence:CCGGGAGCTGTTGGACAGTTTGAATCTCGAGATTCAAACTGTCCAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030121.2-548s1c1
Sequence:CCGGGCTGCCATGAAGGGAAATCTTCTCGAGAAGATTTCCCTTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-575s1c1
Sequence:CCGGGTCAGCATCCTTCTTGATTATCTCGAGATAATCAAGAAGGATGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030121.2-512s1c1
Sequence:CCGGGCCCTGGATTACAACAACGATCTCGAGATCGTTGTTGTAATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030121
VALIDATED
ASB8 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-575s21c1
Sequence:GTACCGGTCAGCATCCTTCTTGATTATGCTCGAGCATAATCAAGAAGGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030121.3-602s21c1
Sequence:GTACCGGAGGTCAGAGTCATCAACTTAACTCGAGTTAAGTTGATGACTCTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-1133s21c1
Sequence:CCGGCTCACTTGTTTGCCGTGTTATCTCGAGATAACACGGCAAACAAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-808s21c1
Sequence:CCGGTCAGCACCAGGGACGCTTAAACTCGAGTTTAAGCGTCCCTGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030121.3-716s21c1
Sequence:CCGGCTGTTGGACAGTTTGAATTAACTCGAGTTAATTCAAACTGTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-1133s1c1
Sequence:CCGGCCTCACTTGTTTGCCGTGTTACTCGAGTAACACGGCAAACAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-714s1c1
Sequence:CCGGGAGCTGTTGGACAGTTTGAATCTCGAGATTCAAACTGTCCAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030121.2-548s1c1
Sequence:CCGGGCTGCCATGAAGGGAAATCTTCTCGAGAAGATTTCCCTTCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030121.2-575s1c1
Sequence:CCGGGTCAGCATCCTTCTTGATTATCTCGAGATAATCAAGAAGGATGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030121.2-512s1c1
Sequence:CCGGGCCCTGGATTACAACAACGATCTCGAGATCGTTGTTGTAATCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks