EMAIL THIS PAGE TO A FRIEND

ASB9

ankyrin repeat and SOCS box containing 9

87 Gene Product Result for
UniProtKB ID: Q96DX5, A8K8A5, Q9BVF5, Q9NWS5, Q9Y4T3
Gene ID:
Human(140462) Summary: This gene encodes a member of the ankyrin repeat and suppressor of cytokine signaling (SOCS) box protein family. Members of this family can interact with the elongin B-C adapter complex via their SOCS box domain and further complex with the cullin and ring box proteins to form E3 ubiquitin ligase complexes. They may function to mediate the substrate-recognition of the E3 ubiquitin ligases. A transcribed pseudogene of this gene has been identified on chromosome 15. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(69299) ankyrin repeat and SOCS box-containing 9
Rat(367785) ankyrin repeat and SOCS box-containing 9
naked mole-rat(101697830) ankyrin repeat and SOCS box containing 9
domestic guinea pig(100733651) ankyrin repeat and SOCS box containing 9
sheep(101123093) ankyrin repeat and SOCS box containing 9
chicken(418625) ankyrin repeat and SOCS box containing 9
cow(784390) ankyrin repeat and SOCS box containing 9
domestic cat(101085527) ankyrin repeat and SOCS box containing 9
dog(480845) ankyrin repeat and SOCS box containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024087 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025961 MISSION® esiRNA esiRNA human ASB9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031739 Rosetta Predictions human pricing
NM_024087 Rosetta Predictions human pricing
XM_346301 Rosetta Predictions rat pricing
NM_027027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128668 predicted 302
2 SASI_Hs01_00128669 predicted 684
3 SASI_Hs02_00307798 predicted 559
4 SASI_Hs02_00307799 predicted 592
5 SASI_Hs02_00307800 predicted 513
6 SASI_Hs01_00128674 predicted 742
7 SASI_Hs01_00128675 predicted 549
8 SASI_Hs01_00128676 predicted 543
9 SASI_Hs01_00128677 predicted 715
10 SASI_Hs02_00307801 predicted 321
11 SASI_Hs01_00128670 predicted 778
12 SASI_Hs01_00128671 predicted 760
13 SASI_Hs01_00128672 predicted 626
14 SASI_Hs01_00128673 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016626 predicted 244
2 SASI_Hs01_00016627 predicted 622
3 SASI_Hs02_00356560 predicted 496
4 SASI_Hs02_00356561 predicted 536
5 SASI_Hs02_00356562 predicted 460
6 SASI_Hs01_00016632 predicted 686
7 SASI_Hs01_00016633 predicted 495
8 SASI_Hs01_00016634 predicted 482
9 SASI_Hs01_00016635 predicted 659
10 SASI_Hs02_00356563 predicted 265
11 SASI_Hs01_00016628 predicted 717
12 SASI_Hs01_00016629 predicted 702
13 SASI_Hs01_00016630 predicted 569
14 SASI_Hs01_00016631 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399242 predicted 691
2 SASI_Rn02_00399243 predicted 224
3 SASI_Rn02_00399244 predicted 583
4 SASI_Rn02_00399245 predicted 421
5 SASI_Rn02_00399246 predicted 390
6 SASI_Rn02_00399247 predicted 652
7 SASI_Rn02_00399248 predicted 634
8 SASI_Rn02_00399249 predicted 713
9 SASI_Rn02_00399250 predicted 566
10 SASI_Rn02_00399251 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331414 predicted 824
2 SASI_Mm02_00331415 predicted 682
3 SASI_Mm02_00331416 predicted 254
4 SASI_Mm02_00331417 predicted 585
5 SASI_Mm02_00331418 predicted 368
6 SASI_Mm02_00331419 predicted 621
7 SASI_Mm02_00331420 predicted 259
8 SASI_Mm02_00331421 predicted 804
9 SASI_Mm02_00331422 predicted 706
10 SASI_Mm02_00331423 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027027
ASB9 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 9
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-340s1c1
Sequence:CCGGGTAAACATCATCACAGCAGATCTCGAGATCTGCTGTGATGATGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-975s1c1
Sequence:CCGGGCAGCATCATAAGATTTCTGACTCGAGTCAGAAATCTTATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-945s1c1
Sequence:CCGGCCTGAGAATCCGGAAATGCTTCTCGAGAAGCATTTCCGGATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027027.1-807s1c1
Sequence:CCGGGCTCATGGATTTCGGAGCAAACTCGAGTTTGCTCCGAAATCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-835s1c1
Sequence:CCGGGCCAAGAATGCTGATGGCAAACTCGAGTTTGCCATCAGCATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027027.2-628s1c1
Sequence:CCGGCCAATATTGACTATAACATCACTCGAGTGATGTTATAGTCAATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027027
ASB9 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 9
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-340s1c1
Sequence:CCGGGTAAACATCATCACAGCAGATCTCGAGATCTGCTGTGATGATGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-975s1c1
Sequence:CCGGGCAGCATCATAAGATTTCTGACTCGAGTCAGAAATCTTATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-945s1c1
Sequence:CCGGCCTGAGAATCCGGAAATGCTTCTCGAGAAGCATTTCCGGATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027027.1-807s1c1
Sequence:CCGGGCTCATGGATTTCGGAGCAAACTCGAGTTTGCTCCGAAATCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-835s1c1
Sequence:CCGGGCCAAGAATGCTGATGGCAAACTCGAGTTTGCCATCAGCATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027027.2-628s1c1
Sequence:CCGGCCAATATTGACTATAACATCACTCGAGTGATGTTATAGTCAATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027027
ASB9 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 9
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-340s1c1
Sequence:CCGGGTAAACATCATCACAGCAGATCTCGAGATCTGCTGTGATGATGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-975s1c1
Sequence:CCGGGCAGCATCATAAGATTTCTGACTCGAGTCAGAAATCTTATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-945s1c1
Sequence:CCGGCCTGAGAATCCGGAAATGCTTCTCGAGAAGCATTTCCGGATTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027027.1-807s1c1
Sequence:CCGGGCTCATGGATTTCGGAGCAAACTCGAGTTTGCTCCGAAATCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027027.1-835s1c1
Sequence:CCGGGCCAAGAATGCTGATGGCAAACTCGAGTTTGCCATCAGCATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027027.2-628s1c1
Sequence:CCGGCCAATATTGACTATAACATCACTCGAGTGATGTTATAGTCAATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024087
ASB9 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and SOCS box containing 9
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-428s1c1
Sequence:CCGGCATCTCTCTTGTGTGAAGATTCTCGAGAATCTTCACACAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-633s1c1
Sequence:CCGGGTGTCAACTCTCTTATAGCTTCTCGAGAAGCTATAAGAGAGTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024087.1-1067s1c1
Sequence:CCGGGCAGCATCATAAGATAACCAACTCGAGTTGGTTATCTTATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-690s1c1
Sequence:CCGGGCACTCCACTCTATTTGGCTTCTCGAGAAGCCAAATAGAGTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-371s1c1
Sequence:CCGGGTGAACATCATCACGGCAGATCTCGAGATCTGCCGTGATGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024087.1-1097s1c1
Sequence:CCGGCCCAGAGGATCTGAAACAGTTCTCGAGAACTGTTTCAGATCCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-866s1c1
Sequence:CCGGGCCAAGAATGCTGAAGGCAAACTCGAGTTTGCCTTCAGCATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-256s1c1
Sequence:CCGGGCTTCTTTCAAACCCATTGATCTCGAGATCAATGGGTTTGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-695s1c1
Sequence:CCGGCCACTCTATTTGGCTTGTGAACTCGAGTTCACAAGCCAAATAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-629s1c1
Sequence:CCGGGAGTGTGTCAACTCTCTTATACTCGAGTATAAGAGAGTTGACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-629s21c1
Sequence:CCGGGAGTGTGTCAACTCTCTTATACTCGAGTATAAGAGAGTTGACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-690s21c1
Sequence:CCGGGCACTCCACTCTATTTGGCTTCTCGAGAAGCCAAATAGAGTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024087.1-1097s21c1
Sequence:CCGGCCCAGAGGATCTGAAACAGTTCTCGAGAACTGTTTCAGATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-428s21c1
Sequence:CCGGCATCTCTCTTGTGTGAAGATTCTCGAGAATCTTCACACAAGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024087
ASB9 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and SOCS box containing 9
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-428s1c1
Sequence:CCGGCATCTCTCTTGTGTGAAGATTCTCGAGAATCTTCACACAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-633s1c1
Sequence:CCGGGTGTCAACTCTCTTATAGCTTCTCGAGAAGCTATAAGAGAGTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024087.1-1067s1c1
Sequence:CCGGGCAGCATCATAAGATAACCAACTCGAGTTGGTTATCTTATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-690s1c1
Sequence:CCGGGCACTCCACTCTATTTGGCTTCTCGAGAAGCCAAATAGAGTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-371s1c1
Sequence:CCGGGTGAACATCATCACGGCAGATCTCGAGATCTGCCGTGATGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024087.1-1097s1c1
Sequence:CCGGCCCAGAGGATCTGAAACAGTTCTCGAGAACTGTTTCAGATCCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-866s1c1
Sequence:CCGGGCCAAGAATGCTGAAGGCAAACTCGAGTTTGCCTTCAGCATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-256s1c1
Sequence:CCGGGCTTCTTTCAAACCCATTGATCTCGAGATCAATGGGTTTGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-695s1c1
Sequence:CCGGCCACTCTATTTGGCTTGTGAACTCGAGTTCACAAGCCAAATAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-629s1c1
Sequence:CCGGGAGTGTGTCAACTCTCTTATACTCGAGTATAAGAGAGTTGACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-629s21c1
Sequence:CCGGGAGTGTGTCAACTCTCTTATACTCGAGTATAAGAGAGTTGACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-690s21c1
Sequence:CCGGGCACTCCACTCTATTTGGCTTCTCGAGAAGCCAAATAGAGTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024087.1-1097s21c1
Sequence:CCGGCCCAGAGGATCTGAAACAGTTCTCGAGAACTGTTTCAGATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-428s21c1
Sequence:CCGGCATCTCTCTTGTGTGAAGATTCTCGAGAATCTTCACACAAGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024087
ASB9 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and SOCS box containing 9
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-428s1c1
Sequence:CCGGCATCTCTCTTGTGTGAAGATTCTCGAGAATCTTCACACAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-633s1c1
Sequence:CCGGGTGTCAACTCTCTTATAGCTTCTCGAGAAGCTATAAGAGAGTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024087.1-1067s1c1
Sequence:CCGGGCAGCATCATAAGATAACCAACTCGAGTTGGTTATCTTATGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-690s1c1
Sequence:CCGGGCACTCCACTCTATTTGGCTTCTCGAGAAGCCAAATAGAGTGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024087.1-371s1c1
Sequence:CCGGGTGAACATCATCACGGCAGATCTCGAGATCTGCCGTGATGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024087.1-1097s1c1
Sequence:CCGGCCCAGAGGATCTGAAACAGTTCTCGAGAACTGTTTCAGATCCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-866s1c1
Sequence:CCGGGCCAAGAATGCTGAAGGCAAACTCGAGTTTGCCTTCAGCATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-256s1c1
Sequence:CCGGGCTTCTTTCAAACCCATTGATCTCGAGATCAATGGGTTTGAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-695s1c1
Sequence:CCGGCCACTCTATTTGGCTTGTGAACTCGAGTTCACAAGCCAAATAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024087.1-629s1c1
Sequence:CCGGGAGTGTGTCAACTCTCTTATACTCGAGTATAAGAGAGTTGACACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-629s21c1
Sequence:CCGGGAGTGTGTCAACTCTCTTATACTCGAGTATAAGAGAGTTGACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-690s21c1
Sequence:CCGGGCACTCCACTCTATTTGGCTTCTCGAGAAGCCAAATAGAGTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024087.1-1097s21c1
Sequence:CCGGCCCAGAGGATCTGAAACAGTTCTCGAGAACTGTTTCAGATCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024087.1-428s21c1
Sequence:CCGGCATCTCTCTTGTGTGAAGATTCTCGAGAATCTTCACACAAGAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks